Mutagenetix > Incidental Mutations

Incidental Mutation 'R5092:Ubr2'

387879

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

042681-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R5092 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46969247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 659 (C659S)

Ref Sequence

ENSEMBL: ENSMUSP00000108963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]

AlphaFold

Q6WKZ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000113335
AA Change: C659S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: C659S

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113337
AA Change: C659S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: C659S

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224759

Predicted Effect

probably benign
Transcript: ENSMUST00000225599

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,987,667		probably benign	Het
4932438A13Rik	A	T	3: 37,000,085	M3118L	probably benign	Het
Abca13	T	A	11: 9,258,535	L236Q	probably damaging	Het
Acp2	A	T	2: 91,208,046	T255S	probably benign	Het
Acsf3	A	C	8: 122,817,392	R536S	probably benign	Het
Adgrb1	T	G	15: 74,529,815	V220G	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atp5b	A	G	10: 128,083,985	Q74R	probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
Capn9	A	G	8: 124,597,525	K188R	probably damaging	Het
Casp8	A	T	1: 58,844,676	N381Y	possibly damaging	Het
Cbwd1	A	T	19: 24,921,019		probably null	Het
Ccdc88b	A	G	19: 6,848,232	S1218P	probably damaging	Het
Cdc42bpg	C	T	19: 6,313,220	P403S	probably benign	Het
Cdkal1	T	A	13: 29,846,239	Y91F	probably damaging	Het
Cdyl2	T	C	8: 116,623,940	N151D	possibly damaging	Het
Cnot1	T	A	8: 95,752,768	R875S	possibly damaging	Het
Cpd	A	G	11: 76,811,704	S613P	possibly damaging	Het
Cyhr1	A	T	15: 76,646,312	F269L	probably benign	Het
Cyp2e1	G	T	7: 140,774,735	R492L	probably damaging	Het
D5Ertd579e	G	A	5: 36,602,703	T1371M	probably benign	Het
Dcaf8	A	G	1: 172,186,909	T394A	probably benign	Het
Dgka	T	C	10: 128,735,833	E117G	probably damaging	Het
Dock4	G	A	12: 40,844,441	V1867I	probably benign	Het
E2f2	G	T	4: 136,186,937	A333S	probably benign	Het
Eif3l	T	C	15: 79,084,154	S208P	probably benign	Het
Elovl3	A	T	19: 46,134,522	H179L	probably damaging	Het
Eml5	T	C	12: 98,792,616	D1766G	probably damaging	Het
Eno4	A	G	19: 58,945,591	T75A	probably benign	Het
Fam135a	C	T	1: 24,028,807	D94N	probably benign	Het
Fasn	G	T	11: 120,815,036	Q1136K	probably benign	Het
Fcer1a	T	G	1: 173,225,455	N58T	probably damaging	Het
Frmd4b	T	A	6: 97,295,980	D763V	probably damaging	Het
Gm43518	A	G	5: 123,938,234	T115A	probably damaging	Het
Gria4	C	T	9: 4,472,176	E438K	probably benign	Het
Grin2d	T	C	7: 45,854,268	E681G	probably damaging	Het
Gtf3c5	G	T	2: 28,582,873	N35K	possibly damaging	Het
Hydin	A	G	8: 110,582,668	T4031A	probably benign	Het
Igfn1	G	T	1: 135,964,826	N2185K	probably benign	Het
Il17rb	T	C	14: 30,002,376	T174A	probably benign	Het
Kdm3b	T	A	18: 34,813,462	C835S	probably benign	Het
Lgi2	A	T	5: 52,538,087	I510N	probably damaging	Het
Map3k6	A	G	4: 133,251,743	E1164G	probably benign	Het
Mpv17l	T	A	16: 13,940,673	M1K	probably null	Het
Myoc	T	A	1: 162,639,634	L124Q	probably damaging	Het
Nbeal2	C	A	9: 110,626,728		probably null	Het
Nek10	A	G	14: 14,820,851	K13E	possibly damaging	Het
Nt5dc2	A	G	14: 31,139,032	H491R	possibly damaging	Het
Olfr1053	T	C	2: 86,314,362	Q308R	probably benign	Het
Olfr1314	A	C	2: 112,092,107	M198R	possibly damaging	Het
Olfr65	T	A	7: 103,907,199	Y250*	probably null	Het
Pclo	T	A	5: 14,677,308		probably benign	Het
Pgm1	A	T	5: 64,107,749	N371I	possibly damaging	Het
Phf20l1	T	A	15: 66,636,913	S873T	possibly damaging	Het
Plch1	T	C	3: 63,698,710	T1249A	probably benign	Het
Plekhn1	A	T	4: 156,224,765	I228N	possibly damaging	Het
Ppp1r12a	A	T	10: 108,267,402		probably null	Het
Ptchd3	T	C	11: 121,831,146	Y282H	probably damaging	Het
Ptprk	T	A	10: 28,592,773	N1396K	probably damaging	Het
Rap1gap2	T	C	11: 74,438,295	E81G	probably damaging	Het
Rpf2	T	C	10: 40,246,975	M1V	probably null	Het
Rpgrip1l	G	A	8: 91,221,384	Q1224*	probably null	Het
Rreb1	A	G	13: 37,928,278	D286G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Senp5	A	T	16: 31,989,142	N431K	probably benign	Het
Serpina1f	A	C	12: 103,693,550	S158A	probably damaging	Het
Sertad3	T	A	7: 27,476,720	I193N	probably damaging	Het
Slc22a8	T	A	19: 8,594,164	N86K	probably damaging	Het
Slc6a2	T	C	8: 92,994,719	V492A	possibly damaging	Het
Slf2	T	A	19: 44,952,084	D773E	probably benign	Het
Slmap	A	C	14: 26,463,589	L272R	probably damaging	Het
Smyd5	T	C	6: 85,445,203		probably benign	Het
Snx21	G	T	2: 164,786,746	R103L	probably damaging	Het
Sphk2	T	A	7: 45,712,353		probably null	Het
Stab1	T	C	14: 31,145,855	K1653E	probably benign	Het
Syde1	A	G	10: 78,589,418	V253A	probably benign	Het
Sympk	G	T	7: 19,042,659	R492L	probably benign	Het
Taar7f	T	C	10: 24,049,553	I15T	probably benign	Het
Tas2r137	A	G	6: 40,491,266	D10G	probably benign	Het
Tbcc	A	G	17: 46,891,674	S329G	probably benign	Het
Teddm3	G	A	16: 21,153,150	T223M	probably benign	Het
Tex14	G	T	11: 87,514,842	C860F	probably benign	Het
Thada	A	T	17: 84,444,468	L360Q	probably damaging	Het
Thop1	C	A	10: 81,080,578	H473Q	probably damaging	Het
Tln2	T	C	9: 67,256,028	D1075G	probably benign	Het
Tmem130	G	A	5: 144,743,718	T292I	probably benign	Het
Tmem198b	T	C	10: 128,801,436	N278S	probably benign	Het
Ttc21a	A	T	9: 119,942,665	T177S	probably benign	Het
Vmn2r4	T	C	3: 64,390,952	K585R	probably benign	Het
Vmn2r86	A	G	10: 130,446,587	I720T	probably damaging	Het
Wdr35	G	T	12: 8,987,327	W311L	probably damaging	Het
Zfp39	A	T	11: 58,891,202	F245I	possibly damaging	Het
Zmym5	G	A	14: 56,796,779	T325I	probably benign	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
R9026:Ubr2	UTSW	17	46934115	missense	probably damaging	1.00
R9216:Ubr2	UTSW	17	46981359	missense	probably benign	0.36
R9339:Ubr2	UTSW	17	46973939	missense	probably benign	0.30
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GATGCAAAATCCTCAATGGCTATG -3'
(R):5'- TTTCTCATAAAGAATGCCTCTCACC -3'

Sequencing Primer
(F):5'- CCTCAATGGCTATGTCCATTTAAAAC -3'
(R):5'- TCTCACCCTCAAATAGATGGAGCTG -3'

Posted On

2016-06-06