Incidental Mutation 'R5093:Grik3'
ID 387910
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 042682-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R5093 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125564382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 455 (T455A)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably benign
Transcript: ENSMUST00000030676
AA Change: T455A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: T455A

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,610,573 (GRCm39) probably benign Het
Abca9 A T 11: 110,032,358 (GRCm39) L753Q probably damaging Het
Acvrl1 A G 15: 101,032,628 (GRCm39) probably null Het
Adgrv1 A T 13: 81,740,704 (GRCm39) N141K probably damaging Het
Aftph C T 11: 20,659,619 (GRCm39) probably null Het
Aifm1 C T X: 47,571,637 (GRCm39) G371S probably benign Het
Aldh3b2 A G 19: 4,029,433 (GRCm39) M269V probably benign Het
Ankrd44 T C 1: 54,802,877 (GRCm39) Y207C probably damaging Het
Arhgap15 G T 2: 44,212,767 (GRCm39) M412I probably damaging Het
Auts2 A C 5: 131,468,296 (GRCm39) L783R probably damaging Het
Baiap2l1 A T 5: 144,215,363 (GRCm39) Y381N probably damaging Het
Baiap3 T C 17: 25,469,243 (GRCm39) D180G probably damaging Het
Cant1 T C 11: 118,302,038 (GRCm39) Y93C probably damaging Het
Catsperg2 T C 7: 29,416,423 (GRCm39) S330G probably benign Het
Ccdc73 A T 2: 104,848,111 (GRCm39) probably benign Het
Cdc5l A T 17: 45,703,967 (GRCm39) F752L possibly damaging Het
Celsr2 G T 3: 108,320,689 (GRCm39) H708N possibly damaging Het
Cep170 T A 1: 176,596,896 (GRCm39) K487M possibly damaging Het
Cerkl A T 2: 79,163,867 (GRCm39) N66K probably damaging Het
Cilk1 G A 9: 78,047,303 (GRCm39) V68I probably benign Het
Clec11a C T 7: 43,954,150 (GRCm39) A268T probably damaging Het
Ctnna2 C A 6: 77,091,912 (GRCm39) probably null Het
Diaph3 C A 14: 87,222,236 (GRCm39) R416L probably damaging Het
Dnmbp T A 19: 43,838,315 (GRCm39) N1170I probably damaging Het
Erbb2 G T 11: 98,318,279 (GRCm39) C505F probably damaging Het
Ercc6 T A 14: 32,289,479 (GRCm39) F904L probably damaging Het
Exo5 C T 4: 120,779,514 (GRCm39) G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,465,302 (GRCm39) probably benign Het
Fbxl5 A G 5: 43,930,896 (GRCm39) Y64H probably damaging Het
Gabra4 T A 5: 71,798,207 (GRCm39) M207L probably damaging Het
Galnt15 T C 14: 31,771,786 (GRCm39) L277P probably damaging Het
Gclm T C 3: 122,049,261 (GRCm39) probably null Het
Gm5493 T A 17: 22,966,201 (GRCm39) C29S possibly damaging Het
Grm3 A G 5: 9,639,766 (GRCm39) V93A probably benign Het
Hdgfl2 C T 17: 56,406,217 (GRCm39) A535V possibly damaging Het
Hfm1 A T 5: 107,049,597 (GRCm39) S455T probably damaging Het
Hmcn1 T A 1: 150,613,007 (GRCm39) D1424V probably benign Het
Hsd3b6 C T 3: 98,715,120 (GRCm39) V91I probably benign Het
Igdcc4 G A 9: 65,030,039 (GRCm39) S363N possibly damaging Het
Intu T C 3: 40,647,347 (GRCm39) V740A probably benign Het
Itga2 C T 13: 114,992,717 (GRCm39) V838I probably benign Het
Kif9 A G 9: 110,318,965 (GRCm39) E143G probably damaging Het
Kmt2c T A 5: 25,614,205 (GRCm39) I172F probably benign Het
Kmt2d G A 15: 98,754,043 (GRCm39) R21W probably damaging Het
Mdh1b A T 1: 63,750,620 (GRCm39) D449E probably benign Het
Meis1 T C 11: 18,831,785 (GRCm39) I418V probably benign Het
Nags T A 11: 102,037,395 (GRCm39) M162K probably damaging Het
Nufip1 A G 14: 76,348,413 (GRCm39) D14G probably benign Het
Or2l13 T A 16: 19,306,227 (GRCm39) I213N probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Or7g28 T G 9: 19,272,274 (GRCm39) I126L probably damaging Het
Osmr A C 15: 6,850,560 (GRCm39) V681G probably damaging Het
Paxip1 G T 5: 27,971,282 (GRCm39) Q356K unknown Het
Pcdhac1 T A 18: 37,223,595 (GRCm39) F136Y probably damaging Het
Pla2g6 A G 15: 79,171,328 (GRCm39) V699A probably benign Het
Plcb3 A T 19: 6,943,578 (GRCm39) V107E probably damaging Het
Plch1 T A 3: 63,681,136 (GRCm39) I164F probably damaging Het
Plpp3 A T 4: 105,052,077 (GRCm39) I73F probably damaging Het
Plscr5 G A 9: 92,080,574 (GRCm39) R20Q probably benign Het
Prdm10 G A 9: 31,252,779 (GRCm39) R504Q probably damaging Het
Prss58 T C 6: 40,874,751 (GRCm39) Y30C probably damaging Het
Psg19 T A 7: 18,530,894 (GRCm39) T87S probably benign Het
Ptpn22 T G 3: 103,789,418 (GRCm39) M294R probably benign Het
Rai1 T A 11: 60,079,482 (GRCm39) M1182K probably benign Het
Sez6 T A 11: 77,867,388 (GRCm39) V795D possibly damaging Het
Shcbp1 A G 8: 4,789,214 (GRCm39) V535A possibly damaging Het
Skint9 A G 4: 112,246,447 (GRCm39) Y222H probably benign Het
Slc13a3 T A 2: 165,253,816 (GRCm39) I446F probably damaging Het
Slc2a3 C T 6: 122,714,196 (GRCm39) R57H probably damaging Het
Slc44a4 A G 17: 35,140,219 (GRCm39) D208G probably benign Het
Spata31d1b A T 13: 59,863,838 (GRCm39) N329Y possibly damaging Het
Strbp C T 2: 37,517,499 (GRCm39) R192K probably damaging Het
Tctn3 A T 19: 40,600,548 (GRCm39) L14Q probably damaging Het
Tenm2 T A 11: 36,834,989 (GRCm39) D2V probably damaging Het
Tln2 T G 9: 67,241,596 (GRCm39) K1003T probably benign Het
Tmem63b T C 17: 45,971,800 (GRCm39) E805G probably damaging Het
Trhr A T 15: 44,060,980 (GRCm39) N167Y probably damaging Het
Trpc2 A G 7: 101,744,390 (GRCm39) R721G probably benign Het
Ttn C A 2: 76,701,267 (GRCm39) probably benign Het
Wdr91 A G 6: 34,869,288 (GRCm39) I412T probably damaging Het
Zcchc4 T A 5: 52,953,952 (GRCm39) S211T probably benign Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0208:Grik3 UTSW 4 125,579,958 (GRCm39) missense probably damaging 1.00
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1515:Grik3 UTSW 4 125,564,521 (GRCm39) missense probably benign 0.37
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6682:Grik3 UTSW 4 125,544,259 (GRCm39) missense probably damaging 1.00
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7790:Grik3 UTSW 4 125,579,812 (GRCm39) missense probably damaging 1.00
R7822:Grik3 UTSW 4 125,550,190 (GRCm39) critical splice donor site probably null
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATATGCCCATGTACTTATGCCATG -3'
(R):5'- CGTGGTCAATGAGTTCCTTGAC -3'

Sequencing Primer
(F):5'- TGGCACATGGCTATAATTGCAGC -3'
(R):5'- GGTCAATGAGTTCCTTGACCATGC -3'
Posted On 2016-06-06