Incidental Mutation 'R5093:Clec11a'
ID387928
Institutional Source Beutler Lab
Gene Symbol Clec11a
Ensembl Gene ENSMUSG00000004473
Gene NameC-type lectin domain family 11, member a
SynonymsClecsf3, Scgf
MMRRC Submission 042682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5093 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44302687-44306902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44304726 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 268 (A268T)
Ref Sequence ENSEMBL: ENSMUSP00000004587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004587]
Predicted Effect probably damaging
Transcript: ENSMUST00000004587
AA Change: A268T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004587
Gene: ENSMUSG00000004473
AA Change: A268T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
CLECT 182 325 1.7e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206467
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin superfamily. The encoded protein is a secreted sulfated glycoprotein and functions as a growth factor for primitive hematopoietic progenitor cells. An alternative splice variant has been described but its biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone volume in limb bones and vertebrae, reduced bone strength, and delayed fracture healing. Bone marrow stromal cells display impaired osteogenic differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,474,037 probably benign Het
Abca9 A T 11: 110,141,532 L753Q probably damaging Het
Acvrl1 A G 15: 101,134,747 probably null Het
Adgrv1 A T 13: 81,592,585 N141K probably damaging Het
Aftph C T 11: 20,709,619 probably null Het
Aifm1 C T X: 48,482,760 G371S probably benign Het
Aldh3b2 A G 19: 3,979,433 M269V probably benign Het
Ankrd44 T C 1: 54,763,718 Y207C probably damaging Het
Arhgap15 G T 2: 44,322,755 M412I probably damaging Het
Auts2 A C 5: 131,439,458 L783R probably damaging Het
Baiap2l1 A T 5: 144,278,553 Y381N probably damaging Het
Baiap3 T C 17: 25,250,269 D180G probably damaging Het
Cant1 T C 11: 118,411,212 Y93C probably damaging Het
Catsperg2 T C 7: 29,716,998 S330G probably benign Het
Ccdc73 A T 2: 105,017,766 probably benign Het
Cdc5l A T 17: 45,393,041 F752L possibly damaging Het
Celsr2 G T 3: 108,413,373 H708N possibly damaging Het
Cep170 T A 1: 176,769,330 K487M possibly damaging Het
Cerkl A T 2: 79,333,523 N66K probably damaging Het
Ctnna2 C A 6: 77,114,929 probably null Het
Diaph3 C A 14: 86,984,800 R416L probably damaging Het
Dnmbp T A 19: 43,849,876 N1170I probably damaging Het
Erbb2 G T 11: 98,427,453 C505F probably damaging Het
Ercc6 T A 14: 32,567,522 F904L probably damaging Het
Exo5 C T 4: 120,922,317 G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Fbxl5 A G 5: 43,773,554 Y64H probably damaging Het
Gabra4 T A 5: 71,640,864 M207L probably damaging Het
Galnt15 T C 14: 32,049,829 L277P probably damaging Het
Gclm T C 3: 122,255,612 probably null Het
Gm5493 T A 17: 22,747,228 C29S possibly damaging Het
Grik3 A G 4: 125,670,589 T455A probably benign Het
Grm3 A G 5: 9,589,766 V93A probably benign Het
Hdgfl2 C T 17: 56,099,217 A535V possibly damaging Het
Hfm1 A T 5: 106,901,731 S455T probably damaging Het
Hmcn1 T A 1: 150,737,256 D1424V probably benign Het
Hsd3b6 C T 3: 98,807,804 V91I probably benign Het
Ick G A 9: 78,140,021 V68I probably benign Het
Igdcc4 G A 9: 65,122,757 S363N possibly damaging Het
Intu T C 3: 40,692,917 V740A probably benign Het
Itga2 C T 13: 114,856,181 V838I probably benign Het
Kif9 A G 9: 110,489,897 E143G probably damaging Het
Kmt2c T A 5: 25,409,207 I172F probably benign Het
Kmt2d G A 15: 98,856,162 R21W probably damaging Het
Mdh1b A T 1: 63,711,461 D449E probably benign Het
Meis1 T C 11: 18,881,785 I418V probably benign Het
Nags T A 11: 102,146,569 M162K probably damaging Het
Nufip1 A G 14: 76,110,973 D14G probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr166 T A 16: 19,487,477 I213N probably damaging Het
Olfr846 T G 9: 19,360,978 I126L probably damaging Het
Osmr A C 15: 6,821,079 V681G probably damaging Het
Paxip1 G T 5: 27,766,284 Q356K unknown Het
Pcdhac1 T A 18: 37,090,542 F136Y probably damaging Het
Pla2g6 A G 15: 79,287,128 V699A probably benign Het
Plcb3 A T 19: 6,966,210 V107E probably damaging Het
Plch1 T A 3: 63,773,715 I164F probably damaging Het
Plpp3 A T 4: 105,194,880 I73F probably damaging Het
Plscr5 G A 9: 92,198,521 R20Q probably benign Het
Prdm10 G A 9: 31,341,483 R504Q probably damaging Het
Prss58 T C 6: 40,897,817 Y30C probably damaging Het
Psg19 T A 7: 18,796,969 T87S probably benign Het
Ptpn22 T G 3: 103,882,102 M294R probably benign Het
Rai1 T A 11: 60,188,656 M1182K probably benign Het
Sez6 T A 11: 77,976,562 V795D possibly damaging Het
Shcbp1 A G 8: 4,739,214 V535A possibly damaging Het
Skint9 A G 4: 112,389,250 Y222H probably benign Het
Slc13a3 T A 2: 165,411,896 I446F probably damaging Het
Slc2a3 C T 6: 122,737,237 R57H probably damaging Het
Slc44a4 A G 17: 34,921,243 D208G probably benign Het
Spata31d1b A T 13: 59,716,024 N329Y possibly damaging Het
Strbp C T 2: 37,627,487 R192K probably damaging Het
Tctn3 A T 19: 40,612,104 L14Q probably damaging Het
Tenm2 T A 11: 36,944,162 D2V probably damaging Het
Tln2 T G 9: 67,334,314 K1003T probably benign Het
Tmem63b T C 17: 45,660,874 E805G probably damaging Het
Trhr A T 15: 44,197,584 N167Y probably damaging Het
Trpc2 A G 7: 102,095,183 R721G probably benign Het
Ttn C A 2: 76,870,923 probably benign Het
Wdr91 A G 6: 34,892,353 I412T probably damaging Het
Zcchc4 T A 5: 52,796,610 S211T probably benign Het
Other mutations in Clec11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0038:Clec11a UTSW 7 44306482 unclassified probably benign
R0038:Clec11a UTSW 7 44306482 unclassified probably benign
R1456:Clec11a UTSW 7 44306450 missense possibly damaging 0.63
R1944:Clec11a UTSW 7 44304674 missense probably benign 0.01
R5138:Clec11a UTSW 7 44304638 missense probably benign
R5642:Clec11a UTSW 7 44306408 missense possibly damaging 0.76
R6126:Clec11a UTSW 7 44304921 missense probably damaging 0.99
R7457:Clec11a UTSW 7 44305955 missense probably benign 0.22
R7513:Clec11a UTSW 7 44306356 missense probably benign 0.34
X0017:Clec11a UTSW 7 44305838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGAAGGGGAACTCGCAG -3'
(R):5'- ACAAGTGCTTCCTGCTCTCG -3'

Sequencing Primer
(F):5'- AAGAACCGTCGTCTGAG -3'
(R):5'- AGACTTCGAGACCCAGGC -3'
Posted On2016-06-06