Incidental Mutation 'R0427:Noc3l'
ID38793
Institutional Source Beutler Lab
Gene Symbol Noc3l
Ensembl Gene ENSMUSG00000024999
Gene NameNOC3 like DNA replication regulator
SynonymsFad24
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0427 (G1)
Quality Score214
Status Not validated
Chromosome19
Chromosomal Location38788128-38819237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38789651 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 773 (Q773R)
Ref Sequence ENSEMBL: ENSMUSP00000025963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025963] [ENSMUST00000169713]
Predicted Effect probably benign
Transcript: ENSMUST00000025963
AA Change: Q773R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025963
Gene: ENSMUSG00000024999
AA Change: Q773R

DomainStartEndE-ValueType
low complexity region 76 103 N/A INTRINSIC
coiled coil region 174 199 N/A INTRINSIC
Pfam:NOC3p 212 307 1.5e-32 PFAM
coiled coil region 449 489 N/A INTRINSIC
Pfam:CBF 554 707 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169713
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality, fail to form blastocele and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Noc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Noc3l APN 19 38815655 missense possibly damaging 0.71
IGL03237:Noc3l APN 19 38814681 splice site probably null
R0062:Noc3l UTSW 19 38814809 missense probably benign 0.01
R0306:Noc3l UTSW 19 38807650 missense probably damaging 0.96
R0409:Noc3l UTSW 19 38817927 splice site probably benign
R0478:Noc3l UTSW 19 38810006 critical splice donor site probably null
R4714:Noc3l UTSW 19 38815713 missense probably benign 0.00
R4720:Noc3l UTSW 19 38789622 missense probably benign 0.00
R4857:Noc3l UTSW 19 38792800 critical splice acceptor site probably null
R4864:Noc3l UTSW 19 38789637 missense probably benign
R5511:Noc3l UTSW 19 38794181 missense probably benign 0.32
R5586:Noc3l UTSW 19 38814695 missense possibly damaging 0.81
R6144:Noc3l UTSW 19 38798955 missense probably damaging 1.00
R6257:Noc3l UTSW 19 38795905 intron probably null
R7095:Noc3l UTSW 19 38812345 missense probably benign 0.01
R7256:Noc3l UTSW 19 38812356 missense probably benign 0.03
R7343:Noc3l UTSW 19 38795024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCCCTCACATATCCTTGTGTCTC -3'
(R):5'- TCTAGTGTCGATCAAAGACCTGACCAA -3'

Sequencing Primer
(F):5'- GTCTCTGCCATGCACATGC -3'
(R):5'- atgtacccatctgtaccttctg -3'
Posted On2013-05-23