Incidental Mutation 'R5093:Shcbp1'
ID387930
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission 042682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5093 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4739214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 535 (V535A)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022945
AA Change: V535A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: V535A

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect probably benign
Transcript: ENSMUST00000207876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,474,037 probably benign Het
Abca9 A T 11: 110,141,532 L753Q probably damaging Het
Acvrl1 A G 15: 101,134,747 probably null Het
Adgrv1 A T 13: 81,592,585 N141K probably damaging Het
Aftph C T 11: 20,709,619 probably null Het
Aifm1 C T X: 48,482,760 G371S probably benign Het
Aldh3b2 A G 19: 3,979,433 M269V probably benign Het
Ankrd44 T C 1: 54,763,718 Y207C probably damaging Het
Arhgap15 G T 2: 44,322,755 M412I probably damaging Het
Auts2 A C 5: 131,439,458 L783R probably damaging Het
Baiap2l1 A T 5: 144,278,553 Y381N probably damaging Het
Baiap3 T C 17: 25,250,269 D180G probably damaging Het
Cant1 T C 11: 118,411,212 Y93C probably damaging Het
Catsperg2 T C 7: 29,716,998 S330G probably benign Het
Ccdc73 A T 2: 105,017,766 probably benign Het
Cdc5l A T 17: 45,393,041 F752L possibly damaging Het
Celsr2 G T 3: 108,413,373 H708N possibly damaging Het
Cep170 T A 1: 176,769,330 K487M possibly damaging Het
Cerkl A T 2: 79,333,523 N66K probably damaging Het
Clec11a C T 7: 44,304,726 A268T probably damaging Het
Ctnna2 C A 6: 77,114,929 probably null Het
Diaph3 C A 14: 86,984,800 R416L probably damaging Het
Dnmbp T A 19: 43,849,876 N1170I probably damaging Het
Erbb2 G T 11: 98,427,453 C505F probably damaging Het
Ercc6 T A 14: 32,567,522 F904L probably damaging Het
Exo5 C T 4: 120,922,317 G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Fbxl5 A G 5: 43,773,554 Y64H probably damaging Het
Gabra4 T A 5: 71,640,864 M207L probably damaging Het
Galnt15 T C 14: 32,049,829 L277P probably damaging Het
Gclm T C 3: 122,255,612 probably null Het
Gm5493 T A 17: 22,747,228 C29S possibly damaging Het
Grik3 A G 4: 125,670,589 T455A probably benign Het
Grm3 A G 5: 9,589,766 V93A probably benign Het
Hdgfl2 C T 17: 56,099,217 A535V possibly damaging Het
Hfm1 A T 5: 106,901,731 S455T probably damaging Het
Hmcn1 T A 1: 150,737,256 D1424V probably benign Het
Hsd3b6 C T 3: 98,807,804 V91I probably benign Het
Ick G A 9: 78,140,021 V68I probably benign Het
Igdcc4 G A 9: 65,122,757 S363N possibly damaging Het
Intu T C 3: 40,692,917 V740A probably benign Het
Itga2 C T 13: 114,856,181 V838I probably benign Het
Kif9 A G 9: 110,489,897 E143G probably damaging Het
Kmt2c T A 5: 25,409,207 I172F probably benign Het
Kmt2d G A 15: 98,856,162 R21W probably damaging Het
Mdh1b A T 1: 63,711,461 D449E probably benign Het
Meis1 T C 11: 18,881,785 I418V probably benign Het
Nags T A 11: 102,146,569 M162K probably damaging Het
Nufip1 A G 14: 76,110,973 D14G probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr166 T A 16: 19,487,477 I213N probably damaging Het
Olfr846 T G 9: 19,360,978 I126L probably damaging Het
Osmr A C 15: 6,821,079 V681G probably damaging Het
Paxip1 G T 5: 27,766,284 Q356K unknown Het
Pcdhac1 T A 18: 37,090,542 F136Y probably damaging Het
Pla2g6 A G 15: 79,287,128 V699A probably benign Het
Plcb3 A T 19: 6,966,210 V107E probably damaging Het
Plch1 T A 3: 63,773,715 I164F probably damaging Het
Plpp3 A T 4: 105,194,880 I73F probably damaging Het
Plscr5 G A 9: 92,198,521 R20Q probably benign Het
Prdm10 G A 9: 31,341,483 R504Q probably damaging Het
Prss58 T C 6: 40,897,817 Y30C probably damaging Het
Psg19 T A 7: 18,796,969 T87S probably benign Het
Ptpn22 T G 3: 103,882,102 M294R probably benign Het
Rai1 T A 11: 60,188,656 M1182K probably benign Het
Sez6 T A 11: 77,976,562 V795D possibly damaging Het
Skint9 A G 4: 112,389,250 Y222H probably benign Het
Slc13a3 T A 2: 165,411,896 I446F probably damaging Het
Slc2a3 C T 6: 122,737,237 R57H probably damaging Het
Slc44a4 A G 17: 34,921,243 D208G probably benign Het
Spata31d1b A T 13: 59,716,024 N329Y possibly damaging Het
Strbp C T 2: 37,627,487 R192K probably damaging Het
Tctn3 A T 19: 40,612,104 L14Q probably damaging Het
Tenm2 T A 11: 36,944,162 D2V probably damaging Het
Tln2 T G 9: 67,334,314 K1003T probably benign Het
Tmem63b T C 17: 45,660,874 E805G probably damaging Het
Trhr A T 15: 44,197,584 N167Y probably damaging Het
Trpc2 A G 7: 102,095,183 R721G probably benign Het
Ttn C A 2: 76,870,923 probably benign Het
Wdr91 A G 6: 34,892,353 I412T probably damaging Het
Zcchc4 T A 5: 52,796,610 S211T probably benign Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 unclassified probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense possibly damaging 0.59
Z1177:Shcbp1 UTSW 8 4736146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATCAGAATTTGGTGCTG -3'
(R):5'- TCCATCACTGCAAGGAAGG -3'

Sequencing Primer
(F):5'- CATCAGAATTTGGTGCTGAAATAGAG -3'
(R):5'- TCACTGCAAGGAAGGAATTCTC -3'
Posted On2016-06-06