Incidental Mutation 'R5093:Ick'
ID387934
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
MMRRC Submission 042682-MU
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R5093 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78140021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 68 (V68I)
Ref Sequence ENSEMBL: ENSMUSP00000113655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably benign
Transcript: ENSMUST00000044551
AA Change: V68I

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: V68I

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117330
AA Change: V68I

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828
AA Change: V68I

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118869
AA Change: V68I

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: V68I

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1260 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,474,037 probably benign Het
Abca9 A T 11: 110,141,532 L753Q probably damaging Het
Acvrl1 A G 15: 101,134,747 probably null Het
Adgrv1 A T 13: 81,592,585 N141K probably damaging Het
Aftph C T 11: 20,709,619 probably null Het
Aifm1 C T X: 48,482,760 G371S probably benign Het
Aldh3b2 A G 19: 3,979,433 M269V probably benign Het
Ankrd44 T C 1: 54,763,718 Y207C probably damaging Het
Arhgap15 G T 2: 44,322,755 M412I probably damaging Het
Auts2 A C 5: 131,439,458 L783R probably damaging Het
Baiap2l1 A T 5: 144,278,553 Y381N probably damaging Het
Baiap3 T C 17: 25,250,269 D180G probably damaging Het
Cant1 T C 11: 118,411,212 Y93C probably damaging Het
Catsperg2 T C 7: 29,716,998 S330G probably benign Het
Ccdc73 A T 2: 105,017,766 probably benign Het
Cdc5l A T 17: 45,393,041 F752L possibly damaging Het
Celsr2 G T 3: 108,413,373 H708N possibly damaging Het
Cep170 T A 1: 176,769,330 K487M possibly damaging Het
Cerkl A T 2: 79,333,523 N66K probably damaging Het
Clec11a C T 7: 44,304,726 A268T probably damaging Het
Ctnna2 C A 6: 77,114,929 probably null Het
Diaph3 C A 14: 86,984,800 R416L probably damaging Het
Dnmbp T A 19: 43,849,876 N1170I probably damaging Het
Erbb2 G T 11: 98,427,453 C505F probably damaging Het
Ercc6 T A 14: 32,567,522 F904L probably damaging Het
Exo5 C T 4: 120,922,317 G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Fbxl5 A G 5: 43,773,554 Y64H probably damaging Het
Gabra4 T A 5: 71,640,864 M207L probably damaging Het
Galnt15 T C 14: 32,049,829 L277P probably damaging Het
Gclm T C 3: 122,255,612 probably null Het
Gm5493 T A 17: 22,747,228 C29S possibly damaging Het
Grik3 A G 4: 125,670,589 T455A probably benign Het
Grm3 A G 5: 9,589,766 V93A probably benign Het
Hdgfl2 C T 17: 56,099,217 A535V possibly damaging Het
Hfm1 A T 5: 106,901,731 S455T probably damaging Het
Hmcn1 T A 1: 150,737,256 D1424V probably benign Het
Hsd3b6 C T 3: 98,807,804 V91I probably benign Het
Igdcc4 G A 9: 65,122,757 S363N possibly damaging Het
Intu T C 3: 40,692,917 V740A probably benign Het
Itga2 C T 13: 114,856,181 V838I probably benign Het
Kif9 A G 9: 110,489,897 E143G probably damaging Het
Kmt2c T A 5: 25,409,207 I172F probably benign Het
Kmt2d G A 15: 98,856,162 R21W probably damaging Het
Mdh1b A T 1: 63,711,461 D449E probably benign Het
Meis1 T C 11: 18,881,785 I418V probably benign Het
Nags T A 11: 102,146,569 M162K probably damaging Het
Nufip1 A G 14: 76,110,973 D14G probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr166 T A 16: 19,487,477 I213N probably damaging Het
Olfr846 T G 9: 19,360,978 I126L probably damaging Het
Osmr A C 15: 6,821,079 V681G probably damaging Het
Paxip1 G T 5: 27,766,284 Q356K unknown Het
Pcdhac1 T A 18: 37,090,542 F136Y probably damaging Het
Pla2g6 A G 15: 79,287,128 V699A probably benign Het
Plcb3 A T 19: 6,966,210 V107E probably damaging Het
Plch1 T A 3: 63,773,715 I164F probably damaging Het
Plpp3 A T 4: 105,194,880 I73F probably damaging Het
Plscr5 G A 9: 92,198,521 R20Q probably benign Het
Prdm10 G A 9: 31,341,483 R504Q probably damaging Het
Prss58 T C 6: 40,897,817 Y30C probably damaging Het
Psg19 T A 7: 18,796,969 T87S probably benign Het
Ptpn22 T G 3: 103,882,102 M294R probably benign Het
Rai1 T A 11: 60,188,656 M1182K probably benign Het
Sez6 T A 11: 77,976,562 V795D possibly damaging Het
Shcbp1 A G 8: 4,739,214 V535A possibly damaging Het
Skint9 A G 4: 112,389,250 Y222H probably benign Het
Slc13a3 T A 2: 165,411,896 I446F probably damaging Het
Slc2a3 C T 6: 122,737,237 R57H probably damaging Het
Slc44a4 A G 17: 34,921,243 D208G probably benign Het
Spata31d1b A T 13: 59,716,024 N329Y possibly damaging Het
Strbp C T 2: 37,627,487 R192K probably damaging Het
Tctn3 A T 19: 40,612,104 L14Q probably damaging Het
Tenm2 T A 11: 36,944,162 D2V probably damaging Het
Tln2 T G 9: 67,334,314 K1003T probably benign Het
Tmem63b T C 17: 45,660,874 E805G probably damaging Het
Trhr A T 15: 44,197,584 N167Y probably damaging Het
Trpc2 A G 7: 102,095,183 R721G probably benign Het
Ttn C A 2: 76,870,923 probably benign Het
Wdr91 A G 6: 34,892,353 I412T probably damaging Het
Zcchc4 T A 5: 52,796,610 S211T probably benign Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R4792:Ick UTSW 9 78153693 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5393:Ick UTSW 9 78160715 missense probably benign
R6199:Ick UTSW 9 78164639 missense probably benign 0.04
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
R7468:Ick UTSW 9 78157939 missense probably benign 0.00
R7660:Ick UTSW 9 78167620 missense probably benign
R7661:Ick UTSW 9 78167620 missense probably benign
R7662:Ick UTSW 9 78167620 missense probably benign
R7666:Ick UTSW 9 78167620 missense probably benign
R7693:Ick UTSW 9 78157726 missense probably benign
R7783:Ick UTSW 9 78135645 missense probably damaging 0.97
R7787:Ick UTSW 9 78167620 missense probably benign
R7788:Ick UTSW 9 78167620 missense probably benign
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAAAATGTAACCCATGGCACCTTC -3'
(R):5'- ACAAAAGGCATGTCTACTTTGC -3'

Sequencing Primer
(F):5'- ATGGCACCTTCTCACTTGGAG -3'
(R):5'- GAGGACCCTTGAGAATTCAGTTCC -3'
Posted On2016-06-06