Incidental Mutation 'R5093:Aftph'
ID387939
Institutional Source Beutler Lab
Gene Symbol Aftph
Ensembl Gene ENSMUSG00000049659
Gene Nameaftiphilin
Synonyms
MMRRC Submission 042682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R5093 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location20685084-20741589 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 20709619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035350] [ENSMUST00000146722] [ENSMUST00000146722] [ENSMUST00000177014] [ENSMUST00000177543]
Predicted Effect probably null
Transcript: ENSMUST00000035350
SMART Domains Protein: ENSMUSP00000036778
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 1.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134897
Predicted Effect probably null
Transcript: ENSMUST00000146722
SMART Domains Protein: ENSMUSP00000121612
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 694 765 1.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146722
SMART Domains Protein: ENSMUSP00000121612
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 694 765 1.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176585
Predicted Effect probably benign
Transcript: ENSMUST00000176782
SMART Domains Protein: ENSMUSP00000134791
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177014
SMART Domains Protein: ENSMUSP00000135450
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 391 405 N/A INTRINSIC
low complexity region 463 476 N/A INTRINSIC
Pfam:Clathrin_bdg 538 610 6.8e-37 PFAM
low complexity region 664 677 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177543
SMART Domains Protein: ENSMUSP00000134991
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 8.7e-37 PFAM
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,474,037 probably benign Het
Abca9 A T 11: 110,141,532 L753Q probably damaging Het
Acvrl1 A G 15: 101,134,747 probably null Het
Adgrv1 A T 13: 81,592,585 N141K probably damaging Het
Aifm1 C T X: 48,482,760 G371S probably benign Het
Aldh3b2 A G 19: 3,979,433 M269V probably benign Het
Ankrd44 T C 1: 54,763,718 Y207C probably damaging Het
Arhgap15 G T 2: 44,322,755 M412I probably damaging Het
Auts2 A C 5: 131,439,458 L783R probably damaging Het
Baiap2l1 A T 5: 144,278,553 Y381N probably damaging Het
Baiap3 T C 17: 25,250,269 D180G probably damaging Het
Cant1 T C 11: 118,411,212 Y93C probably damaging Het
Catsperg2 T C 7: 29,716,998 S330G probably benign Het
Ccdc73 A T 2: 105,017,766 probably benign Het
Cdc5l A T 17: 45,393,041 F752L possibly damaging Het
Celsr2 G T 3: 108,413,373 H708N possibly damaging Het
Cep170 T A 1: 176,769,330 K487M possibly damaging Het
Cerkl A T 2: 79,333,523 N66K probably damaging Het
Clec11a C T 7: 44,304,726 A268T probably damaging Het
Ctnna2 C A 6: 77,114,929 probably null Het
Diaph3 C A 14: 86,984,800 R416L probably damaging Het
Dnmbp T A 19: 43,849,876 N1170I probably damaging Het
Erbb2 G T 11: 98,427,453 C505F probably damaging Het
Ercc6 T A 14: 32,567,522 F904L probably damaging Het
Exo5 C T 4: 120,922,317 G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Fbxl5 A G 5: 43,773,554 Y64H probably damaging Het
Gabra4 T A 5: 71,640,864 M207L probably damaging Het
Galnt15 T C 14: 32,049,829 L277P probably damaging Het
Gclm T C 3: 122,255,612 probably null Het
Gm5493 T A 17: 22,747,228 C29S possibly damaging Het
Grik3 A G 4: 125,670,589 T455A probably benign Het
Grm3 A G 5: 9,589,766 V93A probably benign Het
Hdgfl2 C T 17: 56,099,217 A535V possibly damaging Het
Hfm1 A T 5: 106,901,731 S455T probably damaging Het
Hmcn1 T A 1: 150,737,256 D1424V probably benign Het
Hsd3b6 C T 3: 98,807,804 V91I probably benign Het
Ick G A 9: 78,140,021 V68I probably benign Het
Igdcc4 G A 9: 65,122,757 S363N possibly damaging Het
Intu T C 3: 40,692,917 V740A probably benign Het
Itga2 C T 13: 114,856,181 V838I probably benign Het
Kif9 A G 9: 110,489,897 E143G probably damaging Het
Kmt2c T A 5: 25,409,207 I172F probably benign Het
Kmt2d G A 15: 98,856,162 R21W probably damaging Het
Mdh1b A T 1: 63,711,461 D449E probably benign Het
Meis1 T C 11: 18,881,785 I418V probably benign Het
Nags T A 11: 102,146,569 M162K probably damaging Het
Nufip1 A G 14: 76,110,973 D14G probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr166 T A 16: 19,487,477 I213N probably damaging Het
Olfr846 T G 9: 19,360,978 I126L probably damaging Het
Osmr A C 15: 6,821,079 V681G probably damaging Het
Paxip1 G T 5: 27,766,284 Q356K unknown Het
Pcdhac1 T A 18: 37,090,542 F136Y probably damaging Het
Pla2g6 A G 15: 79,287,128 V699A probably benign Het
Plcb3 A T 19: 6,966,210 V107E probably damaging Het
Plch1 T A 3: 63,773,715 I164F probably damaging Het
Plpp3 A T 4: 105,194,880 I73F probably damaging Het
Plscr5 G A 9: 92,198,521 R20Q probably benign Het
Prdm10 G A 9: 31,341,483 R504Q probably damaging Het
Prss58 T C 6: 40,897,817 Y30C probably damaging Het
Psg19 T A 7: 18,796,969 T87S probably benign Het
Ptpn22 T G 3: 103,882,102 M294R probably benign Het
Rai1 T A 11: 60,188,656 M1182K probably benign Het
Sez6 T A 11: 77,976,562 V795D possibly damaging Het
Shcbp1 A G 8: 4,739,214 V535A possibly damaging Het
Skint9 A G 4: 112,389,250 Y222H probably benign Het
Slc13a3 T A 2: 165,411,896 I446F probably damaging Het
Slc2a3 C T 6: 122,737,237 R57H probably damaging Het
Slc44a4 A G 17: 34,921,243 D208G probably benign Het
Spata31d1b A T 13: 59,716,024 N329Y possibly damaging Het
Strbp C T 2: 37,627,487 R192K probably damaging Het
Tctn3 A T 19: 40,612,104 L14Q probably damaging Het
Tenm2 T A 11: 36,944,162 D2V probably damaging Het
Tln2 T G 9: 67,334,314 K1003T probably benign Het
Tmem63b T C 17: 45,660,874 E805G probably damaging Het
Trhr A T 15: 44,197,584 N167Y probably damaging Het
Trpc2 A G 7: 102,095,183 R721G probably benign Het
Ttn C A 2: 76,870,923 probably benign Het
Wdr91 A G 6: 34,892,353 I412T probably damaging Het
Zcchc4 T A 5: 52,796,610 S211T probably benign Het
Other mutations in Aftph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Aftph APN 11 20727483 missense probably damaging 1.00
IGL01485:Aftph APN 11 20692507 missense probably damaging 1.00
IGL01622:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01623:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01739:Aftph APN 11 20726994 missense probably damaging 0.98
IGL01777:Aftph APN 11 20726554 missense possibly damaging 0.49
IGL01825:Aftph APN 11 20726569 missense possibly damaging 0.77
IGL02804:Aftph APN 11 20726107 missense possibly damaging 0.89
IGL03003:Aftph APN 11 20726982 nonsense probably null
IGL03111:Aftph APN 11 20726040 missense probably benign 0.44
R1103:Aftph UTSW 11 20726547 missense probably benign 0.00
R1672:Aftph UTSW 11 20726762 missense probably benign 0.10
R2060:Aftph UTSW 11 20692571 missense probably damaging 1.00
R2141:Aftph UTSW 11 20698318 nonsense probably null
R2241:Aftph UTSW 11 20726328 missense possibly damaging 0.90
R2513:Aftph UTSW 11 20708676 splice site probably null
R2518:Aftph UTSW 11 20725797 missense probably damaging 0.98
R4751:Aftph UTSW 11 20727074 missense probably damaging 1.00
R4844:Aftph UTSW 11 20708667 splice site probably benign
R4879:Aftph UTSW 11 20698311 critical splice donor site probably null
R4895:Aftph UTSW 11 20696801 missense probably damaging 1.00
R5012:Aftph UTSW 11 20698264 intron probably benign
R5082:Aftph UTSW 11 20727100 missense probably damaging 0.98
R5160:Aftph UTSW 11 20712197 missense probably benign 0.03
R5288:Aftph UTSW 11 20726994 missense probably damaging 0.98
R5338:Aftph UTSW 11 20727203 missense probably benign 0.18
R5794:Aftph UTSW 11 20726955 unclassified probably null
R6747:Aftph UTSW 11 20726144 synonymous probably null
R6876:Aftph UTSW 11 20709744 missense probably damaging 1.00
R7034:Aftph UTSW 11 20692498 missense probably damaging 1.00
R7284:Aftph UTSW 11 20726812 missense probably benign 0.00
R7371:Aftph UTSW 11 20726836 missense probably benign
X0028:Aftph UTSW 11 20726338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCAGAGGAACATTATGATGTC -3'
(R):5'- CAGTGTACTGAAGGTTAAGTTTACGGG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TTAAGTTTACGGGGAAGGGGC -3'
Posted On2016-06-06