Incidental Mutation 'R5094:Pfdn2'
ID 387975
Institutional Source Beutler Lab
Gene Symbol Pfdn2
Ensembl Gene ENSMUSG00000006412
Gene Name prefoldin 2
Synonyms ESTM27, W48336
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5094 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171345670-171359254 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 171356499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006579] [ENSMUST00000061878] [ENSMUST00000135941]
AlphaFold O70591
Predicted Effect probably benign
Transcript: ENSMUST00000006579
SMART Domains Protein: ENSMUSP00000006579
Gene: ENSMUSG00000006412

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Prefoldin_2 18 93 3e-24 PFAM
low complexity region 102 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061878
SMART Domains Protein: ENSMUSP00000056212
Gene: ENSMUSG00000045259

DomainStartEndE-ValueType
Pfam:Kelch_5 255 297 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135941
SMART Domains Protein: ENSMUSP00000120106
Gene: ENSMUSG00000006412

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Prefoldin_2 24 129 3.3e-32 PFAM
low complexity region 139 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192266
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Pfdn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4576001:Pfdn2 UTSW 1 171345742 missense unknown
R6021:Pfdn2 UTSW 1 171345770 unclassified probably benign
R6023:Pfdn2 UTSW 1 171356751 missense probably damaging 1.00
R6712:Pfdn2 UTSW 1 171357851 missense probably damaging 1.00
R6980:Pfdn2 UTSW 1 171357897 unclassified probably benign
R7332:Pfdn2 UTSW 1 171356594 missense probably damaging 1.00
R9174:Pfdn2 UTSW 1 171356596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAAATCTCTTGTAGGTGTTCC -3'
(R):5'- GAACAAGACCTCAGAATGCGTC -3'

Sequencing Primer
(F):5'- AGGTGTTCCAGTGGCTCCTC -3'
(R):5'- GACCTCAGAATGCGTCCTGATC -3'
Posted On 2016-06-06