Incidental Mutation 'R5094:Olfr1051'
ID387977
Institutional Source Beutler Lab
Gene Symbol Olfr1051
Ensembl Gene ENSMUSG00000075193
Gene Nameolfactory receptor 1051
SynonymsGA_x6K02T2Q125-47756192-47755266, MOR187-5
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86273814-86279088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86276040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 149 (Y149F)
Ref Sequence ENSEMBL: ENSMUSP00000150061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099898] [ENSMUST00000216432] [ENSMUST00000217245] [ENSMUST00000217294]
Predicted Effect probably damaging
Transcript: ENSMUST00000099898
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097482
Gene: ENSMUSG00000075193
AA Change: Y149F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-53 PFAM
Pfam:7tm_1 41 290 2.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216432
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217245
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217294
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Olfr1051
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Olfr1051 APN 2 86275741 missense probably damaging 0.99
IGL02263:Olfr1051 APN 2 86276202 missense probably benign 0.01
IGL03143:Olfr1051 APN 2 86276236 missense probably benign 0.03
R1182:Olfr1051 UTSW 2 86276268 missense probably damaging 0.98
R1475:Olfr1051 UTSW 2 86275561 makesense probably null
R1712:Olfr1051 UTSW 2 86275993 missense probably damaging 0.97
R1903:Olfr1051 UTSW 2 86275846 missense probably benign 0.00
R2097:Olfr1051 UTSW 2 86276039 nonsense probably null
R4680:Olfr1051 UTSW 2 86276173 missense possibly damaging 0.88
R4879:Olfr1051 UTSW 2 86275763 nonsense probably null
R6448:Olfr1051 UTSW 2 86276347 missense probably benign 0.07
R8250:Olfr1051 UTSW 2 86276154 missense probably damaging 1.00
X0064:Olfr1051 UTSW 2 86276118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACGCATTCGAAATATGG -3'
(R):5'- ACCTATTATGCTTGTGCCACAC -3'

Sequencing Primer
(F):5'- CAGAACGCATTCGAAATATGGTTAAC -3'
(R):5'- ATGCTTGTGCCACACAGATG -3'
Posted On2016-06-06