Mutagenetix > Incidental Mutation

Incidental Mutation 'R5094:Dnajc2'

387980

Institutional Source

Beutler Lab

Gene Symbol

Dnajc2

Ensembl Gene

ENSMUSG00000029014

Gene Name

DnaJ heat shock protein family (Hsp40) member C2

Synonyms

MIDA1, Zrf1, Mida1, Zrf2

MMRRC Submission

042683-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R5094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21757267-21785251 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21776732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 139 (T139A)

Ref Sequence

ENSEMBL: ENSMUSP00000110846 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000115192] [ENSMUST00000115193] [ENSMUST00000115195]

AlphaFold

P54103

Predicted Effect

probably damaging
Transcript: ENSMUST00000030771
AA Change: T139A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014
AA Change: T139A

Domain	Start	End	E-Value	Type
coiled coil region	39	67	N/A	INTRINSIC
DnaJ	87	153	2.16e-18	SMART
low complexity region	231	245	N/A	INTRINSIC
low complexity region	281	319	N/A	INTRINSIC
Pfam:RAC_head	339	430	2.8e-24	PFAM
SANT	450	509	6.64e-10	SMART
SANT	550	602	2.4e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115192
AA Change: T139A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110846
Gene: ENSMUSG00000029014
AA Change: T139A

Domain	Start	End	E-Value	Type
coiled coil region	39	67	N/A	INTRINSIC
DnaJ	87	153	2.16e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115193
AA Change: T139A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014
AA Change: T139A

Domain	Start	End	E-Value	Type
coiled coil region	39	67	N/A	INTRINSIC
DnaJ	87	153	2.16e-18	SMART
coiled coil region	230	358	N/A	INTRINSIC
coiled coil region	404	445	N/A	INTRINSIC
SANT	450	509	6.64e-10	SMART
SANT	550	602	1.34e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115195
AA Change: T65A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014
AA Change: T65A

Domain	Start	End	E-Value	Type
DnaJ	13	79	2.16e-18	SMART
coiled coil region	156	284	N/A	INTRINSIC
coiled coil region	330	371	N/A	INTRINSIC
SANT	376	435	6.64e-10	SMART
SANT	476	528	2.4e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147987

Meta Mutation Damage Score

0.3369

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

91% (40/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	G	T	15: 82,062,682	G260V	possibly damaging	Het
Agap3	T	C	5: 24,451,321		probably benign	Het
Bicra	A	G	7: 15,975,371	S1173P	probably damaging	Het
C3	A	T	17: 57,225,033		probably null	Het
Cdh18	G	A	15: 22,714,539		probably benign	Het
Cep290	A	G	10: 100,567,030	K2274E	probably damaging	Het
Cfap54	T	C	10: 92,898,999		probably benign	Het
Chat	T	A	14: 32,408,939	I582F	probably damaging	Het
Chrnb4	T	C	9: 55,035,313	I226V	probably benign	Het
Eml1	T	C	12: 108,536,311	F712S	probably benign	Het
Fgfr1	C	T	8: 25,570,165	S524L	probably damaging	Het
Gimap3	T	C	6: 48,765,372	E208G	probably damaging	Het
Gm12185	T	A	11: 48,907,548	D706V	probably benign	Het
Gucy1a2	T	A	9: 3,865,443	V639D	probably damaging	Het
Hivep2	T	C	10: 14,132,149	F1497S	probably benign	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Ifit3b	T	A	19: 34,612,548	S375T	possibly damaging	Het
Mucl1	A	G	15: 103,755,403	S13P	possibly damaging	Het
Olfr1051	T	A	2: 86,276,040	Y149F	probably damaging	Het
Olfr1135	C	T	2: 87,671,830	C179Y	possibly damaging	Het
Pah	T	A	10: 87,538,219	Y78*	probably null	Het
Pex13	A	G	11: 23,655,441	V263A	probably benign	Het
Pfdn2	T	A	1: 171,356,499		probably benign	Het
Phip	C	T	9: 82,871,844	V1616I	probably benign	Het
Pigg	A	G	5: 108,336,257	S457G	possibly damaging	Het
Ppp1r13b	A	G	12: 111,843,610	S97P	probably benign	Het
Slc22a6	T	C	19: 8,626,177	L535P	probably damaging	Het
Slc5a1	A	G	5: 33,158,280	T548A	probably damaging	Het
Smtnl2	T	A	11: 72,400,385	S346C	probably damaging	Het
Spata31d1a	A	G	13: 59,705,044		probably null	Het
Tlcd2	T	C	11: 75,469,814	S228P	probably benign	Het
Tmem135	A	G	7: 89,143,793	L411P	probably damaging	Het
Tnrc6c	T	C	11: 117,721,046	V170A	probably benign	Het

Other mutations in Dnajc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Dnajc2	APN	5	21774976	missense	possibly damaging	0.83
IGL01479:Dnajc2	APN	5	21757893	missense	probably damaging	1.00
IGL01804:Dnajc2	APN	5	21757363	missense	probably damaging	1.00
IGL02478:Dnajc2	APN	5	21776790	missense	probably damaging	1.00
IGL02552:Dnajc2	APN	5	21783063	missense	probably damaging	1.00
IGL02657:Dnajc2	APN	5	21770481	splice site	probably benign
IGL02832:Dnajc2	APN	5	21760410	missense	probably benign
IGL03177:Dnajc2	APN	5	21775081	splice site	probably benign
R1914:Dnajc2	UTSW	5	21781319	critical splice donor site	probably null
R1915:Dnajc2	UTSW	5	21781319	critical splice donor site	probably null
R2024:Dnajc2	UTSW	5	21776790	missense	probably damaging	1.00
R2437:Dnajc2	UTSW	5	21760391	missense	probably benign	0.06
R4177:Dnajc2	UTSW	5	21757396	missense	probably benign	0.28
R4451:Dnajc2	UTSW	5	21757794	missense	possibly damaging	0.93
R4812:Dnajc2	UTSW	5	21763486	missense	probably benign	0.03
R4916:Dnajc2	UTSW	5	21757340	missense	probably damaging	1.00
R5013:Dnajc2	UTSW	5	21757773	nonsense	probably null
R5124:Dnajc2	UTSW	5	21763484	missense	probably benign
R5891:Dnajc2	UTSW	5	21761711	missense	possibly damaging	0.67
R6192:Dnajc2	UTSW	5	21768648	missense	probably damaging	1.00
R6567:Dnajc2	UTSW	5	21766678	missense	probably damaging	1.00
R7211:Dnajc2	UTSW	5	21776779	missense	probably damaging	1.00
R7216:Dnajc2	UTSW	5	21776779	missense	probably damaging	1.00
R7418:Dnajc2	UTSW	5	21760624	critical splice donor site	probably null
R7728:Dnajc2	UTSW	5	21770540	missense	possibly damaging	0.62
R7877:Dnajc2	UTSW	5	21760639	missense	possibly damaging	0.88
R8156:Dnajc2	UTSW	5	21781319	critical splice donor site	probably null
R8231:Dnajc2	UTSW	5	21761691	missense	probably benign	0.00
R8360:Dnajc2	UTSW	5	21757707	missense	unknown
R8880:Dnajc2	UTSW	5	21768672	missense	probably damaging	1.00
R9648:Dnajc2	UTSW	5	21763480	missense	probably damaging	0.98
RF040:Dnajc2	UTSW	5	21757697	makesense	probably null
X0027:Dnajc2	UTSW	5	21773811	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CAACCTTGCTGTAGTGAAGCTC -3'
(R):5'- TATAGGGGACTTTCAGGATAGCATTTG -3'

Sequencing Primer
(F):5'- CTGTAGTGAAGCTCTGCAGAAACTAC -3'
(R):5'- GGACTTTCAGGATAGCATTTGAAATG -3'

Posted On

2016-06-06