Incidental Mutation 'R5094:Dnajc2'
ID387980
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21776732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000110846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000115192] [ENSMUST00000115193] [ENSMUST00000115195]
Predicted Effect probably damaging
Transcript: ENSMUST00000030771
AA Change: T139A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014
AA Change: T139A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115192
AA Change: T139A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110846
Gene: ENSMUSG00000029014
AA Change: T139A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115193
AA Change: T139A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014
AA Change: T139A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115195
AA Change: T65A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014
AA Change: T65A

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147987
Meta Mutation Damage Score 0.3369 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1914:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4451:Dnajc2 UTSW 5 21757794 missense possibly damaging 0.93
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R5891:Dnajc2 UTSW 5 21761711 missense possibly damaging 0.67
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
R7877:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
R8156:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R8231:Dnajc2 UTSW 5 21761691 missense probably benign 0.00
R8360:Dnajc2 UTSW 5 21757707 missense unknown
RF040:Dnajc2 UTSW 5 21757697 makesense probably null
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAACCTTGCTGTAGTGAAGCTC -3'
(R):5'- TATAGGGGACTTTCAGGATAGCATTTG -3'

Sequencing Primer
(F):5'- CTGTAGTGAAGCTCTGCAGAAACTAC -3'
(R):5'- GGACTTTCAGGATAGCATTTGAAATG -3'
Posted On2016-06-06