Incidental Mutation 'R5094:Slc5a1'
ID387982
Institutional Source Beutler Lab
Gene Symbol Slc5a1
Ensembl Gene ENSMUSG00000011034
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 1
SynonymsSglt1, sodium glucose cotransporter 1
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33104219-33162870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33158280 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 548 (T548A)
Ref Sequence ENSEMBL: ENSMUSP00000011178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011178]
Predicted Effect probably damaging
Transcript: ENSMUST00000011178
AA Change: T548A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: T548A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 2.6e-174 PFAM
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Meta Mutation Damage Score 0.2351 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Slc5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Slc5a1 APN 5 33160865 missense probably benign
IGL01872:Slc5a1 APN 5 33154637 missense probably damaging 0.97
IGL01906:Slc5a1 APN 5 33154653 missense probably damaging 1.00
IGL02614:Slc5a1 APN 5 33154601 missense probably benign 0.02
IGL03241:Slc5a1 APN 5 33133405 missense probably benign 0.00
IGL03336:Slc5a1 APN 5 33146943 missense probably benign 0.24
R0314:Slc5a1 UTSW 5 33146651 missense probably benign 0.02
R0421:Slc5a1 UTSW 5 33134652 missense probably damaging 1.00
R0755:Slc5a1 UTSW 5 33133389 missense probably benign 0.14
R0791:Slc5a1 UTSW 5 33158077 splice site probably benign
R1506:Slc5a1 UTSW 5 33154708 missense possibly damaging 0.72
R1801:Slc5a1 UTSW 5 33146953 missense probably damaging 1.00
R2143:Slc5a1 UTSW 5 33160796 missense probably benign
R2190:Slc5a1 UTSW 5 33104593 critical splice donor site probably null
R3796:Slc5a1 UTSW 5 33152652 missense probably damaging 1.00
R4423:Slc5a1 UTSW 5 33154674 missense possibly damaging 0.49
R4465:Slc5a1 UTSW 5 33146516 missense possibly damaging 0.89
R4588:Slc5a1 UTSW 5 33145288 missense probably benign 0.01
R4722:Slc5a1 UTSW 5 33146711 missense possibly damaging 0.86
R4826:Slc5a1 UTSW 5 33159150 missense probably benign
R4934:Slc5a1 UTSW 5 33104514 missense probably benign
R4955:Slc5a1 UTSW 5 33160902 missense probably benign 0.02
R4963:Slc5a1 UTSW 5 33160782 missense probably benign 0.00
R5008:Slc5a1 UTSW 5 33152573 missense possibly damaging 0.75
R5292:Slc5a1 UTSW 5 33158241 missense probably benign
R5654:Slc5a1 UTSW 5 33146611 missense probably benign 0.00
R6784:Slc5a1 UTSW 5 33158116 missense probably benign 0.00
R7585:Slc5a1 UTSW 5 33160944 missense probably damaging 1.00
R7734:Slc5a1 UTSW 5 33160935 missense probably benign
R7751:Slc5a1 UTSW 5 33133417 missense possibly damaging 0.63
R7827:Slc5a1 UTSW 5 33146713 missense probably damaging 1.00
RF020:Slc5a1 UTSW 5 33133429 missense probably damaging 1.00
X0064:Slc5a1 UTSW 5 33134636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTGGGCTTCCTGATTGG -3'
(R):5'- TCATCTGAAGTCTGGGCTGTAAG -3'

Sequencing Primer
(F):5'- GGAATCTCCCGTATGATCACTGAG -3'
(R):5'- ACTTGTACCAGACAGTGCTG -3'
Posted On2016-06-06