Incidental Mutation 'R5094:Gimap3'
ID387985
Institutional Source Beutler Lab
Gene Symbol Gimap3
Ensembl Gene ENSMUSG00000039264
Gene NameGTPase, IMAP family member 3
SynonymsIan4, 2010110D23Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48764464-48770851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48765372 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 208 (E208G)
Ref Sequence ENSEMBL: ENSMUSP00000145211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038811] [ENSMUST00000204036]
Predicted Effect probably damaging
Transcript: ENSMUST00000038811
AA Change: E208G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047435
Gene: ENSMUSG00000039264
AA Change: E208G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204036
AA Change: E208G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145211
Gene: ENSMUSG00000039264
AA Change: E208G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: This gene encodes a mitochondrial membrane protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The expression of this gene is induced in BCR/ABL-expressing cells. The encoded protein lacks an N-terminal mitochondrial signal sequence. Experimental studies showed that mitochondrial localization relies on the C-terminal transmembrane domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1 [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Gimap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Gimap3 APN 6 48765496 missense probably damaging 1.00
IGL02141:Gimap3 APN 6 48765378 missense probably benign 0.42
IGL02751:Gimap3 APN 6 48765238 missense probably benign
R0333:Gimap3 UTSW 6 48765730 nonsense probably null
R1081:Gimap3 UTSW 6 48765152 nonsense probably null
R1911:Gimap3 UTSW 6 48765712 missense possibly damaging 0.80
R1936:Gimap3 UTSW 6 48765749 missense probably damaging 1.00
R2990:Gimap3 UTSW 6 48765851 missense probably damaging 0.98
R4052:Gimap3 UTSW 6 48766513 missense possibly damaging 0.53
R4433:Gimap3 UTSW 6 48765946 missense possibly damaging 0.53
R4571:Gimap3 UTSW 6 48765720 missense possibly damaging 0.74
R4672:Gimap3 UTSW 6 48765753 missense probably damaging 0.99
R4709:Gimap3 UTSW 6 48765393 missense probably benign 0.02
R5510:Gimap3 UTSW 6 48765249 missense possibly damaging 0.93
R6876:Gimap3 UTSW 6 48765921 missense probably damaging 1.00
R7359:Gimap3 UTSW 6 48765346 missense probably benign 0.26
R7923:Gimap3 UTSW 6 48765627 missense probably benign 0.33
R8322:Gimap3 UTSW 6 48765436 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTTTGCCTATGGGGAGGACC -3'
(R):5'- GAGGCACATGATCGTCCTCTTC -3'

Sequencing Primer
(F):5'- CCTATGGGGAGGACCTTGAG -3'
(R):5'- ATCGTCCTCTTCACCCGCAAG -3'
Posted On2016-06-06