Incidental Mutation 'R5094:Bicra'
ID 387986
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene Name BRD4 interacting chromatin remodeling complex associated protein
Synonyms Gltscr1
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R5094 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 15970672-16047921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15975371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1173 (S1173P)
Ref Sequence ENSEMBL: ENSMUSP00000148012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]
AlphaFold F8VPZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000094821
AA Change: S1173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: S1173P

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210713
Predicted Effect probably damaging
Transcript: ENSMUST00000210781
AA Change: S1173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15996577 missense possibly damaging 0.70
IGL01521:Bicra APN 7 15989188 missense probably benign 0.18
IGL01690:Bicra APN 7 15987753 missense probably benign 0.09
IGL01721:Bicra APN 7 15988699 missense probably benign
IGL01994:Bicra APN 7 15972816 missense possibly damaging 0.46
IGL02084:Bicra APN 7 15987738 missense probably benign 0.09
IGL02312:Bicra APN 7 15993141 missense possibly damaging 0.85
IGL02686:Bicra APN 7 15987915 missense probably benign 0.02
IGL02727:Bicra APN 7 15979465 missense possibly damaging 0.95
IGL03031:Bicra APN 7 15975801 missense probably benign 0.16
R0003:Bicra UTSW 7 15971887 missense probably benign
R0025:Bicra UTSW 7 15987511 missense possibly damaging 0.53
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0417:Bicra UTSW 7 15972322 missense probably damaging 1.00
R0437:Bicra UTSW 7 15988762 missense possibly damaging 0.73
R0547:Bicra UTSW 7 15972248 missense probably damaging 1.00
R0688:Bicra UTSW 7 15989322 missense probably damaging 1.00
R0855:Bicra UTSW 7 15972004 missense probably damaging 1.00
R1448:Bicra UTSW 7 15988359 missense possibly damaging 0.86
R1637:Bicra UTSW 7 15972689 missense probably benign 0.19
R1899:Bicra UTSW 7 15987751 missense possibly damaging 0.53
R2035:Bicra UTSW 7 15996413 missense possibly damaging 0.53
R2247:Bicra UTSW 7 15989234 missense probably benign 0.33
R2471:Bicra UTSW 7 15972332 missense probably benign 0.04
R2484:Bicra UTSW 7 15988680 missense possibly damaging 0.96
R3437:Bicra UTSW 7 15989298 missense possibly damaging 0.85
R3551:Bicra UTSW 7 15979733 missense probably benign 0.33
R4816:Bicra UTSW 7 15988906 missense possibly damaging 0.53
R4901:Bicra UTSW 7 15987601 missense possibly damaging 0.53
R5035:Bicra UTSW 7 15979424 missense possibly damaging 0.90
R5078:Bicra UTSW 7 15975457 missense probably damaging 1.00
R5195:Bicra UTSW 7 15979953 missense possibly damaging 0.93
R5496:Bicra UTSW 7 15987841 missense probably benign 0.33
R5780:Bicra UTSW 7 15979754 missense possibly damaging 0.96
R6541:Bicra UTSW 7 15979129 missense probably benign 0.00
R6560:Bicra UTSW 7 15989194 missense possibly damaging 0.53
R6575:Bicra UTSW 7 15979131 missense probably benign 0.25
R6854:Bicra UTSW 7 15988762 missense probably benign 0.18
R6967:Bicra UTSW 7 15972205 missense probably damaging 0.97
R7283:Bicra UTSW 7 15972500 missense probably damaging 1.00
R7454:Bicra UTSW 7 15972134 missense probably benign 0.30
R7462:Bicra UTSW 7 15979135 missense possibly damaging 0.84
R7488:Bicra UTSW 7 15989442 critical splice acceptor site probably null
R7506:Bicra UTSW 7 15988213 missense possibly damaging 0.96
R7534:Bicra UTSW 7 15971935 missense probably damaging 0.98
R7915:Bicra UTSW 7 15988522 missense probably benign
R8063:Bicra UTSW 7 15979044 missense probably benign
R8147:Bicra UTSW 7 15988470 missense possibly damaging 0.93
R8699:Bicra UTSW 7 15989188 missense probably benign 0.18
R8784:Bicra UTSW 7 15971950 missense probably damaging 1.00
R8859:Bicra UTSW 7 15987812 missense possibly damaging 0.73
R8971:Bicra UTSW 7 15987556 missense probably benign 0.08
X0064:Bicra UTSW 7 15975775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTCTGGGTTGATAGAAAGG -3'
(R):5'- TCAGTATTCAGGCCACGGAG -3'

Sequencing Primer
(F):5'- CTCTGGGTTGATAGAAAGGACATATG -3'
(R):5'- CATTGCGTGCTTGCCCG -3'
Posted On 2016-06-06