Incidental Mutation 'R5094:Tmem135'
ID387987
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Nametransmembrane protein 135
Synonyms
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89139714-89404222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89143793 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 411 (L411P)
Ref Sequence ENSEMBL: ENSMUSP00000042783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000117852]
Predicted Effect probably damaging
Transcript: ENSMUST00000041968
AA Change: L411P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428
AA Change: L411P

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117852
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207335
Meta Mutation Damage Score 0.7511 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 89151438 missense probably damaging 1.00
IGL01730:Tmem135 APN 7 89148044 missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 89143857 unclassified probably benign
IGL02177:Tmem135 APN 7 89338453 missense probably damaging 1.00
IGL02305:Tmem135 APN 7 89165123 critical splice donor site probably null
IGL02747:Tmem135 APN 7 89144670 missense probably damaging 0.98
IGL02801:Tmem135 APN 7 89154125 missense probably benign 0.13
IGL03353:Tmem135 APN 7 89141953 missense probably damaging 1.00
skim UTSW 7 89196127 nonsense probably null
R0631:Tmem135 UTSW 7 89143788 nonsense probably null
R0657:Tmem135 UTSW 7 89144682 missense probably damaging 0.96
R2233:Tmem135 UTSW 7 89154074 missense probably damaging 1.00
R3118:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R3119:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R5225:Tmem135 UTSW 7 89196127 nonsense probably null
R5248:Tmem135 UTSW 7 89147992 missense probably damaging 1.00
R5356:Tmem135 UTSW 7 89305515 missense probably benign 0.06
R5372:Tmem135 UTSW 7 89165174 splice site probably null
R5442:Tmem135 UTSW 7 89144664 missense probably damaging 1.00
R5789:Tmem135 UTSW 7 89196122 missense possibly damaging 0.73
R5863:Tmem135 UTSW 7 89147968 critical splice donor site probably null
R6158:Tmem135 UTSW 7 89156444 missense probably benign 0.12
R6383:Tmem135 UTSW 7 89144670 missense probably damaging 0.98
R6416:Tmem135 UTSW 7 89147794 missense probably benign
R6659:Tmem135 UTSW 7 89307163 missense probably benign 0.07
R6659:Tmem135 UTSW 7 89307164 nonsense probably null
R6731:Tmem135 UTSW 7 89243964 missense possibly damaging 0.96
R7545:Tmem135 UTSW 7 89305519 missense probably damaging 1.00
R7626:Tmem135 UTSW 7 89156510 splice site probably null
R8089:Tmem135 UTSW 7 89156495 missense probably damaging 0.99
R8447:Tmem135 UTSW 7 89154032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGTGAGCACATTAATCTAG -3'
(R):5'- AACGGCCATTCATGCTTCCTG -3'

Sequencing Primer
(F):5'- AAGAACATTCCCTCAGGG -3'
(R):5'- GGCCATTCATGCTTCCTGATAAAG -3'
Posted On2016-06-06