Incidental Mutation 'R5094:Fgfr1'
ID387988
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Namefibroblast growth factor receptor 1
SynonymsEask, Hspy, Fgfr-1, Flt-2
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25513654-25575718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25570165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 524 (S524L)
Ref Sequence ENSEMBL: ENSMUSP00000113909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000167764] [ENSMUST00000178276] [ENSMUST00000179592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084027
AA Change: S526L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: S526L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117179
AA Change: S524L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: S524L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119398
AA Change: S437L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565
AA Change: S437L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133936
Predicted Effect probably benign
Transcript: ENSMUST00000138104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145218
Predicted Effect probably damaging
Transcript: ENSMUST00000167764
AA Change: S437L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565
AA Change: S437L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178276
AA Change: S437L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565
AA Change: S437L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179592
AA Change: S537L

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: S537L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211419
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 25562223 nonsense probably null
IGL01537:Fgfr1 APN 8 25555579 missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 25566735 missense probably benign 0.01
IGL01875:Fgfr1 APN 8 25573553 missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 25555711 missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 25573608 nonsense probably null
IGL02822:Fgfr1 APN 8 25557802 missense probably benign 0.13
IGL03292:Fgfr1 APN 8 25557755 missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 25568198 missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 25557768 missense probably damaging 0.99
R0730:Fgfr1 UTSW 8 25555744 missense probably benign
R1144:Fgfr1 UTSW 8 25558143 missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 25562276 missense possibly damaging 0.81
R1591:Fgfr1 UTSW 8 25572720 missense probably damaging 1.00
R1754:Fgfr1 UTSW 8 25570210 missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 25558215 missense probably benign 0.04
R2139:Fgfr1 UTSW 8 25570866 missense probably damaging 1.00
R2314:Fgfr1 UTSW 8 25570893 missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 25563446 missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 25558211 missense probably benign 0.04
R3796:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3797:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 25573899 missense probably benign 0.37
R4594:Fgfr1 UTSW 8 25573836 missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 25557797 missense probably benign 0.25
R4696:Fgfr1 UTSW 8 25563488 missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 25563526 critical splice donor site probably null
R4966:Fgfr1 UTSW 8 25572445 nonsense probably null
R5730:Fgfr1 UTSW 8 25573811 missense probably damaging 1.00
R5911:Fgfr1 UTSW 8 25519309 utr 5 prime probably benign
R7310:Fgfr1 UTSW 8 25562315 missense probably benign 0.01
R7326:Fgfr1 UTSW 8 25573839 missense probably damaging 1.00
R7404:Fgfr1 UTSW 8 25555550 missense probably benign
R7611:Fgfr1 UTSW 8 25558205 nonsense probably null
R7681:Fgfr1 UTSW 8 25555661 missense probably damaging 0.98
R7738:Fgfr1 UTSW 8 25558185 missense probably damaging 0.96
R7789:Fgfr1 UTSW 8 25562313 nonsense probably null
R7958:Fgfr1 UTSW 8 25532342 missense probably benign
R8206:Fgfr1 UTSW 8 25570242 missense probably damaging 1.00
R8236:Fgfr1 UTSW 8 25562272 nonsense probably null
Z1177:Fgfr1 UTSW 8 25563398 missense probably benign 0.00
Z1177:Fgfr1 UTSW 8 25570768 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTGCAGTGTCTCCAGCTACC -3'
(R):5'- CACACTGTGAATCTGGGTGTTG -3'

Sequencing Primer
(F):5'- GCTACCCTCAGTACTACATGGTAG -3'
(R):5'- ACCTTAAATGAATGCCAATCAGG -3'
Posted On2016-06-06