Incidental Mutation 'R5094:Gucy1a2'
ID387989
Institutional Source Beutler Lab
Gene Symbol Gucy1a2
Ensembl Gene ENSMUSG00000041624
Gene Nameguanylate cyclase 1, soluble, alpha 2
Synonyms6330407I18Rik, A230060L24Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location3532778-3894736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3865443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 639 (V639D)
Ref Sequence ENSEMBL: ENSMUSP00000111398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115733]
Predicted Effect probably damaging
Transcript: ENSMUST00000115733
AA Change: V639D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111398
Gene: ENSMUSG00000041624
AA Change: V639D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 51 72 N/A INTRINSIC
Pfam:HNOB 121 268 3e-19 PFAM
PDB:4GJ4|D 316 441 1e-17 PDB
CYCc 483 674 6.58e-93 SMART
low complexity region 701 715 N/A INTRINSIC
Meta Mutation Damage Score 0.9508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display normal blood vessel and platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Gucy1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Gucy1a2 APN 9 3759418 missense probably damaging 1.00
IGL00768:Gucy1a2 APN 9 3635111 missense possibly damaging 0.65
IGL00928:Gucy1a2 APN 9 3759777 missense probably damaging 1.00
IGL01520:Gucy1a2 APN 9 3759561 missense probably damaging 0.99
IGL01566:Gucy1a2 APN 9 3634661 missense probably damaging 1.00
IGL01819:Gucy1a2 APN 9 3865409 nonsense probably null
IGL01874:Gucy1a2 APN 9 3797343 missense probably damaging 1.00
IGL02442:Gucy1a2 APN 9 3865385 missense probably damaging 1.00
IGL02608:Gucy1a2 APN 9 3635113 missense probably damaging 0.99
IGL02612:Gucy1a2 APN 9 3894556 missense possibly damaging 0.74
IGL02719:Gucy1a2 APN 9 3894719 utr 3 prime probably benign
IGL02823:Gucy1a2 APN 9 3894656 missense possibly damaging 0.79
IGL02852:Gucy1a2 APN 9 3759691 missense probably benign 0.31
IGL02892:Gucy1a2 APN 9 3634471 missense probably damaging 1.00
IGL02964:Gucy1a2 APN 9 3759542 missense probably damaging 0.96
Rico UTSW 9 3579513 splice site probably null
R0096:Gucy1a2 UTSW 9 3758928 intron probably benign
R0417:Gucy1a2 UTSW 9 3759484 missense possibly damaging 0.80
R0920:Gucy1a2 UTSW 9 3759472 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1384:Gucy1a2 UTSW 9 3759620 missense probably damaging 1.00
R1631:Gucy1a2 UTSW 9 3533052 missense probably damaging 1.00
R1711:Gucy1a2 UTSW 9 3759622 missense probably benign 0.04
R1730:Gucy1a2 UTSW 9 3634957 missense probably benign 0.36
R1800:Gucy1a2 UTSW 9 3582685 missense possibly damaging 0.62
R2069:Gucy1a2 UTSW 9 3582697 missense probably damaging 1.00
R2166:Gucy1a2 UTSW 9 3579513 splice site probably null
R2357:Gucy1a2 UTSW 9 3797299 missense probably damaging 0.97
R3401:Gucy1a2 UTSW 9 3635154 missense probably benign 0.00
R3953:Gucy1a2 UTSW 9 3582704 splice site probably benign
R4420:Gucy1a2 UTSW 9 3634640 missense probably damaging 1.00
R4731:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4732:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4733:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4931:Gucy1a2 UTSW 9 3759588 missense probably damaging 1.00
R5852:Gucy1a2 UTSW 9 3865460 missense probably damaging 0.99
R6005:Gucy1a2 UTSW 9 3865518 splice site probably null
R7667:Gucy1a2 UTSW 9 3759580 missense probably damaging 1.00
R7841:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7866:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
R8525:Gucy1a2 UTSW 9 3865365 missense probably damaging 1.00
R8802:Gucy1a2 UTSW 9 3635050 missense probably benign 0.03
Z1176:Gucy1a2 UTSW 9 3635156 missense probably damaging 1.00
Z1177:Gucy1a2 UTSW 9 3797245 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTCTGAACAAACATGTAC -3'
(R):5'- TTACGGTCACTCTATCTCAGACTG -3'

Sequencing Primer
(F):5'- CTTTTTTAGATGCGGATAGGC -3'
(R):5'- GGTCACTCTATCTCAGACTGAAAAC -3'
Posted On2016-06-06