Incidental Mutation 'R5094:Phip'
ID 387991
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Name pleckstrin homology domain interacting protein
Synonyms Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission 042683-MU
Accession Numbers

Genbank: NM_001081216; MGI: 1932404
Essential gene? Essential (E-score: 1.000) question?
Stock # R5094 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 82866159-82975516 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82871844 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1616 (V1616I)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034787
AA Change: V1616I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: V1616I

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
R7598:Phip UTSW 9 82905658 missense possibly damaging 0.94
R7632:Phip UTSW 9 82903190 missense probably benign
R7752:Phip UTSW 9 82890150 missense probably benign
R7827:Phip UTSW 9 82908833 missense probably benign
R7901:Phip UTSW 9 82890150 missense probably benign
R7960:Phip UTSW 9 82893348 missense probably benign 0.00
R8006:Phip UTSW 9 82890126 missense possibly damaging 0.93
R8066:Phip UTSW 9 82875298 missense probably benign 0.05
R8080:Phip UTSW 9 82887609 missense probably damaging 1.00
R8135:Phip UTSW 9 82930374 missense probably benign 0.09
R8347:Phip UTSW 9 82908763 missense probably benign 0.02
R8459:Phip UTSW 9 82876053 missense probably benign
R8705:Phip UTSW 9 82893559 missense probably damaging 0.99
R8706:Phip UTSW 9 82905712 missense possibly damaging 0.89
R8743:Phip UTSW 9 82927087 missense probably benign 0.18
R8801:Phip UTSW 9 82876252 missense probably benign 0.22
R8930:Phip UTSW 9 82906988 missense possibly damaging 0.67
R8932:Phip UTSW 9 82906988 missense possibly damaging 0.67
R8969:Phip UTSW 9 82926964 intron probably benign
R9064:Phip UTSW 9 82871487 missense probably benign 0.20
R9332:Phip UTSW 9 82875359 missense probably damaging 0.98
R9335:Phip UTSW 9 82932926 missense probably benign 0.03
R9520:Phip UTSW 9 82871384 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAGTTTTCCTGCTTTGCACAC -3'
(R):5'- TGTTAGGCTAGGAGAGAGCTC -3'

Sequencing Primer
(F):5'- ACACTGCAGATTCTTGGGC -3'
(R):5'- GAGAGAGCTCCCTCCTCCTC -3'
Posted On 2016-06-06