Mutagenetix > Incidental Mutations

Incidental Mutation 'R5094:Pah'

387993

Institutional Source

Beutler Lab

Gene Symbol

Pah

Ensembl Gene

ENSMUSG00000020051

Gene Name

phenylalanine hydroxylase

Synonyms

AW106920, OTTMUSP00000027786, PH, PKU, PKU1

MMRRC Submission

042683-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87521795-87584136 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 87538219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 78 (Y78*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]

AlphaFold

P16331

Predicted Effect

probably null
Transcript: ENSMUST00000020241
AA Change: Y82*

SMART Domains

Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051
AA Change: Y82*

Domain	Start	End	E-Value	Type
Pfam:ACT	35	100	1.8e-10	PFAM
Pfam:Biopterin_H	119	449	1.3e-177	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143624
AA Change: Y78*

Predicted Effect

probably null
Transcript: ENSMUST00000218573
AA Change: Y78*

Predicted Effect

probably benign
Transcript: ENSMUST00000219813

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

91% (40/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	G	T	15: 82,062,682	G260V	possibly damaging	Het
Agap3	T	C	5: 24,451,321		probably benign	Het
Bicra	A	G	7: 15,975,371	S1173P	probably damaging	Het
C3	A	T	17: 57,225,033		probably null	Het
Cdh18	G	A	15: 22,714,539		probably benign	Het
Cep290	A	G	10: 100,567,030	K2274E	probably damaging	Het
Cfap54	T	C	10: 92,898,999		probably benign	Het
Chat	T	A	14: 32,408,939	I582F	probably damaging	Het
Chrnb4	T	C	9: 55,035,313	I226V	probably benign	Het
Dnajc2	T	C	5: 21,776,732	T139A	probably damaging	Het
Eml1	T	C	12: 108,536,311	F712S	probably benign	Het
Fgfr1	C	T	8: 25,570,165	S524L	probably damaging	Het
Gimap3	T	C	6: 48,765,372	E208G	probably damaging	Het
Gm12185	T	A	11: 48,907,548	D706V	probably benign	Het
Gucy1a2	T	A	9: 3,865,443	V639D	probably damaging	Het
Hivep2	T	C	10: 14,132,149	F1497S	probably benign	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Ifit3b	T	A	19: 34,612,548	S375T	possibly damaging	Het
Mucl1	A	G	15: 103,755,403	S13P	possibly damaging	Het
Olfr1051	T	A	2: 86,276,040	Y149F	probably damaging	Het
Olfr1135	C	T	2: 87,671,830	C179Y	possibly damaging	Het
Pex13	A	G	11: 23,655,441	V263A	probably benign	Het
Pfdn2	T	A	1: 171,356,499		probably benign	Het
Phip	C	T	9: 82,871,844	V1616I	probably benign	Het
Pigg	A	G	5: 108,336,257	S457G	possibly damaging	Het
Ppp1r13b	A	G	12: 111,843,610	S97P	probably benign	Het
Slc22a6	T	C	19: 8,626,177	L535P	probably damaging	Het
Slc5a1	A	G	5: 33,158,280	T548A	probably damaging	Het
Smtnl2	T	A	11: 72,400,385	S346C	probably damaging	Het
Spata31d1a	A	G	13: 59,705,044		probably null	Het
Tlcd2	T	C	11: 75,469,814	S228P	probably benign	Het
Tmem135	A	G	7: 89,143,793	L411P	probably damaging	Het
Tnrc6c	T	C	11: 117,721,046	V170A	probably benign	Het

Other mutations in Pah

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Pah	APN	10	87578893	missense	probably benign	0.02
IGL00823:Pah	APN	10	87570331	missense	probably null	1.00
IGL01350:Pah	APN	10	87578359	intron	probably benign
IGL01668:Pah	APN	10	87578261	missense	probably damaging	1.00
IGL01794:Pah	APN	10	87578922	missense	possibly damaging	0.63
IGL01956:Pah	APN	10	87538199	missense	probably benign	0.03
IGL01985:Pah	APN	10	87578982	missense	probably damaging	1.00
IGL02014:Pah	APN	10	87581927	missense	probably benign	0.00
IGL02552:Pah	APN	10	87578845	intron	probably benign
IGL03096:Pah	APN	10	87538242	critical splice donor site	probably null
bronze	UTSW	10	87570226	missense	probably damaging	1.00
parakeet	UTSW	10	87576215	critical splice donor site	probably null
skeet	UTSW	10	87538219	nonsense	probably null
R0238:Pah	UTSW	10	87567281	missense	possibly damaging	0.74
R0239:Pah	UTSW	10	87567281	missense	possibly damaging	0.74
R0239:Pah	UTSW	10	87567281	missense	possibly damaging	0.74
R0839:Pah	UTSW	10	87522062	missense	probably damaging	1.00
R0853:Pah	UTSW	10	87576218	splice site	probably null
R1474:Pah	UTSW	10	87578313	missense	probably damaging	1.00
R1762:Pah	UTSW	10	87567468	missense	possibly damaging	0.91
R1886:Pah	UTSW	10	87528328	missense	possibly damaging	0.91
R2179:Pah	UTSW	10	87567335	missense	probably damaging	1.00
R2852:Pah	UTSW	10	87567465	missense	probably damaging	1.00
R3818:Pah	UTSW	10	87522004	start gained	probably benign
R4509:Pah	UTSW	10	87576215	critical splice donor site	probably null
R4725:Pah	UTSW	10	87554376	missense	probably damaging	1.00
R4911:Pah	UTSW	10	87570267	missense	probably benign	0.42
R5766:Pah	UTSW	10	87567347	missense	probably damaging	1.00
R6210:Pah	UTSW	10	87583561	missense	probably benign	0.01
R6273:Pah	UTSW	10	87576215	critical splice donor site	probably null
R6345:Pah	UTSW	10	87576187	missense	probably damaging	1.00
R6349:Pah	UTSW	10	87578969	missense	probably benign	0.01
R7109:Pah	UTSW	10	87570286	missense	probably damaging	1.00
R7470:Pah	UTSW	10	87563424	missense	probably damaging	1.00
R7511:Pah	UTSW	10	87554387	missense	probably damaging	1.00
R8288:Pah	UTSW	10	87538185	missense	probably benign	0.00
R8447:Pah	UTSW	10	87581965	critical splice donor site	probably null
R8684:Pah	UTSW	10	87578965	missense	probably benign
R9216:Pah	UTSW	10	87522026	missense	probably benign	0.06
R9292:Pah	UTSW	10	87567356	missense	probably damaging	1.00
Z1088:Pah	UTSW	10	87571291	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCCTGCTCTTCAACTCTAG -3'
(R):5'- CTAGGCCTTTGTCTAGGTCCTTAG -3'

Sequencing Primer
(F):5'- AACTCTAGTTGTTCTGGCTCTG -3'
(R):5'- ATGCCCACGTTGTTATGTATGC -3'

Posted On

2016-06-06