Incidental Mutation 'R5094:Pah'
ID387993
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Namephenylalanine hydroxylase
SynonymsAW106920, OTTMUSP00000027786, PH, PKU, PKU1
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location87521795-87584136 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87538219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 78 (Y78*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
Predicted Effect probably null
Transcript: ENSMUST00000020241
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051
AA Change: Y82*

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143624
AA Change: Y78*
Predicted Effect probably null
Transcript: ENSMUST00000218573
AA Change: Y78*
Predicted Effect probably benign
Transcript: ENSMUST00000219813
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.02
IGL00823:Pah APN 10 87570331 missense probably null 1.00
IGL01350:Pah APN 10 87578359 intron probably benign
IGL01668:Pah APN 10 87578261 missense probably damaging 1.00
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.63
IGL01956:Pah APN 10 87538199 missense probably benign 0.03
IGL01985:Pah APN 10 87578982 missense probably damaging 1.00
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 intron probably benign
IGL03096:Pah APN 10 87538242 critical splice donor site probably null
bronze UTSW 10 87570226 missense probably damaging 1.00
parakeet UTSW 10 87576215 critical splice donor site probably null
skeet UTSW 10 87538219 nonsense probably null
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably damaging 1.00
R0853:Pah UTSW 10 87576218 splice site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense possibly damaging 0.91
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R3818:Pah UTSW 10 87522004 start gained probably benign
R4509:Pah UTSW 10 87576215 critical splice donor site probably null
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
R6210:Pah UTSW 10 87583561 missense probably benign 0.01
R6273:Pah UTSW 10 87576215 critical splice donor site probably null
R6345:Pah UTSW 10 87576187 missense probably damaging 1.00
R6349:Pah UTSW 10 87578969 missense probably benign 0.01
R7109:Pah UTSW 10 87570286 missense probably damaging 1.00
R7470:Pah UTSW 10 87563424 missense probably damaging 1.00
R7511:Pah UTSW 10 87554387 missense probably damaging 1.00
R8288:Pah UTSW 10 87538185 missense probably benign 0.00
R8447:Pah UTSW 10 87581965 critical splice donor site probably null
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTGCTCTTCAACTCTAG -3'
(R):5'- CTAGGCCTTTGTCTAGGTCCTTAG -3'

Sequencing Primer
(F):5'- AACTCTAGTTGTTCTGGCTCTG -3'
(R):5'- ATGCCCACGTTGTTATGTATGC -3'
Posted On2016-06-06