Incidental Mutation 'R5094:Pex13'
ID387996
Institutional Source Beutler Lab
Gene Symbol Pex13
Ensembl Gene ENSMUSG00000020283
Gene Nameperoxisomal biogenesis factor 13
Synonyms
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23646479-23665959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23655441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000020523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020523] [ENSMUST00000130811]
PDB Structure
Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020523
AA Change: V263A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020523
Gene: ENSMUSG00000020283
AA Change: V263A

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:Peroxin-13_N 101 256 3.6e-51 PFAM
SH3 277 337 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124839
Predicted Effect probably benign
Transcript: ENSMUST00000130811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146533
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted disruption of this gene results in intrauterine growth retardation, hypotonia, aphagia, abnormal lamination of the cerebral cortex associated with a neuronal migration defect, liver steatosis, delayed differentiation of renal glomeruli, impairedperoxisome metabolism, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Pex13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Pex13 APN 11 23656111 missense probably benign
Pitch UTSW 11 23655949 missense probably benign
yaw UTSW 11 23649527 missense possibly damaging 0.58
R0455:Pex13 UTSW 11 23655949 missense probably benign
R0671:Pex13 UTSW 11 23665831 missense possibly damaging 0.57
R1454:Pex13 UTSW 11 23649422 missense probably benign
R1738:Pex13 UTSW 11 23649458 missense probably benign
R1830:Pex13 UTSW 11 23655513 missense probably damaging 0.96
R2349:Pex13 UTSW 11 23655789 missense probably damaging 0.96
R4688:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R5727:Pex13 UTSW 11 23655705 missense probably benign 0.02
R6360:Pex13 UTSW 11 23655690 missense probably benign 0.17
R6837:Pex13 UTSW 11 23649527 missense possibly damaging 0.58
R6957:Pex13 UTSW 11 23655628 missense probably benign
R7167:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R7880:Pex13 UTSW 11 23649369 missense probably benign 0.26
R7898:Pex13 UTSW 11 23650929 critical splice donor site probably null
R8000:Pex13 UTSW 11 23655915 missense probably damaging 1.00
R8284:Pex13 UTSW 11 23655685 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCACCAGGTTAATGTG -3'
(R):5'- TCTGAGAATGAGGACCTGTGGG -3'

Sequencing Primer
(F):5'- GCAAGCCTTACTTTGTTACA -3'
(R):5'- ACCTGTGGGCAGAAAGTG -3'
Posted On2016-06-06