Mutagenetix > Incidental Mutations

Incidental Mutation 'R5094:Gm12185'

387997

Institutional Source

Beutler Lab

Gene Symbol

Gm12185

Ensembl Gene

ENSMUSG00000048852

Gene Name

predicted gene 12185

Synonyms

MMRRC Submission

042683-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48904656-48992226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48907548 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 706 (D706V)

Ref Sequence

ENSEMBL: ENSMUSP00000092049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]

Predicted Effect

probably benign
Transcript: ENSMUST00000059930
AA Change: D706V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: D706V

Domain	Start	End	E-Value	Type
Pfam:IIGP	27	389	8.4e-123	PFAM
Pfam:MMR_HSR1	63	190	2.2e-9	PFAM
low complexity region	421	432	N/A	INTRINSIC
Pfam:IIGP	438	811	3.4e-152	PFAM
Pfam:MMR_HSR1	474	632	1.4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094476
AA Change: D706V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: D706V

Domain	Start	End	E-Value	Type
Pfam:IIGP	27	389	1e-122	PFAM
Pfam:DLIC	43	98	3.2e-5	PFAM
Pfam:MMR_HSR1	63	187	6e-9	PFAM
low complexity region	421	432	N/A	INTRINSIC
Pfam:IIGP	438	811	8.9e-153	PFAM
Pfam:MMR_HSR1	474	615	2.6e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

91% (40/44)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	G	T	15: 82,062,682	G260V	possibly damaging	Het
Agap3	T	C	5: 24,451,321		probably benign	Het
Bicra	A	G	7: 15,975,371	S1173P	probably damaging	Het
C3	A	T	17: 57,225,033		probably null	Het
Cdh18	G	A	15: 22,714,539		probably benign	Het
Cep290	A	G	10: 100,567,030	K2274E	probably damaging	Het
Cfap54	T	C	10: 92,898,999		probably benign	Het
Chat	T	A	14: 32,408,939	I582F	probably damaging	Het
Chrnb4	T	C	9: 55,035,313	I226V	probably benign	Het
Dnajc2	T	C	5: 21,776,732	T139A	probably damaging	Het
Eml1	T	C	12: 108,536,311	F712S	probably benign	Het
Fgfr1	C	T	8: 25,570,165	S524L	probably damaging	Het
Gimap3	T	C	6: 48,765,372	E208G	probably damaging	Het
Gucy1a2	T	A	9: 3,865,443	V639D	probably damaging	Het
Hivep2	T	C	10: 14,132,149	F1497S	probably benign	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Ifit3b	T	A	19: 34,612,548	S375T	possibly damaging	Het
Mucl1	A	G	15: 103,755,403	S13P	possibly damaging	Het
Olfr1051	T	A	2: 86,276,040	Y149F	probably damaging	Het
Olfr1135	C	T	2: 87,671,830	C179Y	possibly damaging	Het
Pah	T	A	10: 87,538,219	Y78*	probably null	Het
Pex13	A	G	11: 23,655,441	V263A	probably benign	Het
Pfdn2	T	A	1: 171,356,499		probably benign	Het
Phip	C	T	9: 82,871,844	V1616I	probably benign	Het
Pigg	A	G	5: 108,336,257	S457G	possibly damaging	Het
Ppp1r13b	A	G	12: 111,843,610	S97P	probably benign	Het
Slc22a6	T	C	19: 8,626,177	L535P	probably damaging	Het
Slc5a1	A	G	5: 33,158,280	T548A	probably damaging	Het
Smtnl2	T	A	11: 72,400,385	S346C	probably damaging	Het
Spata31d1a	A	G	13: 59,705,044		probably null	Het
Tlcd2	T	C	11: 75,469,814	S228P	probably benign	Het
Tmem135	A	G	7: 89,143,793	L411P	probably damaging	Het
Tnrc6c	T	C	11: 117,721,046	V170A	probably benign	Het

Other mutations in Gm12185

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gm12185	APN	11	48907222	missense	probably benign	0.01
IGL00495:Gm12185	APN	11	48907861	missense	probably damaging	0.99
IGL01763:Gm12185	APN	11	48915844	missense	probably benign	0.07
IGL01919:Gm12185	APN	11	48908059	missense	possibly damaging	0.90
IGL03388:Gm12185	APN	11	48908286	missense	probably benign	0.01
IGL03404:Gm12185	APN	11	48908037	missense	probably damaging	1.00
PIT4458001:Gm12185	UTSW	11	48907911	missense	probably damaging	1.00
R0347:Gm12185	UTSW	11	48915182	missense	probably benign	0.29
R0488:Gm12185	UTSW	11	48907839	missense	probably damaging	1.00
R1168:Gm12185	UTSW	11	48915355	missense	possibly damaging	0.60
R1223:Gm12185	UTSW	11	48907276	missense	probably damaging	0.98
R1417:Gm12185	UTSW	11	48907842	missense	probably damaging	1.00
R1468:Gm12185	UTSW	11	48915674	missense	possibly damaging	0.60
R1468:Gm12185	UTSW	11	48915674	missense	possibly damaging	0.60
R1519:Gm12185	UTSW	11	48907767	missense	probably damaging	1.00
R1558:Gm12185	UTSW	11	48915435	missense	probably damaging	0.99
R1630:Gm12185	UTSW	11	48907890	missense	probably benign	0.31
R1758:Gm12185	UTSW	11	48908032	missense	possibly damaging	0.82
R1793:Gm12185	UTSW	11	48915756	nonsense	probably null
R1908:Gm12185	UTSW	11	48915404	missense	probably benign	0.00
R1983:Gm12185	UTSW	11	48915356	missense	probably benign	0.01
R3917:Gm12185	UTSW	11	48915933	missense	probably benign	0.01
R3969:Gm12185	UTSW	11	48907345	missense	probably benign	0.03
R3970:Gm12185	UTSW	11	48907345	missense	probably benign	0.03
R4510:Gm12185	UTSW	11	48908478	missense	possibly damaging	0.84
R4511:Gm12185	UTSW	11	48908478	missense	possibly damaging	0.84
R4529:Gm12185	UTSW	11	48907920	missense	probably damaging	1.00
R4529:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4532:Gm12185	UTSW	11	48907920	missense	probably damaging	1.00
R4532:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4533:Gm12185	UTSW	11	48907920	missense	probably damaging	1.00
R4533:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4678:Gm12185	UTSW	11	48915540	missense	probably benign	0.05
R5238:Gm12185	UTSW	11	48908217	missense	possibly damaging	0.92
R5306:Gm12185	UTSW	11	48915555	missense	probably benign	0.03
R5371:Gm12185	UTSW	11	48915739	missense	probably benign	0.01
R5995:Gm12185	UTSW	11	48915713	missense	probably benign	0.40
R6113:Gm12185	UTSW	11	48915340	missense	possibly damaging	0.47
R6147:Gm12185	UTSW	11	48915890	missense	probably benign
R6160:Gm12185	UTSW	11	48908428	nonsense	probably null
R6247:Gm12185	UTSW	11	48915908	missense	probably damaging	0.98
R6264:Gm12185	UTSW	11	48916175	missense	probably benign	0.01
R6748:Gm12185	UTSW	11	48916296	missense	possibly damaging	0.53
R6765:Gm12185	UTSW	11	48915704	missense	probably benign	0.12
R6970:Gm12185	UTSW	11	48907912	nonsense	probably null
R7028:Gm12185	UTSW	11	48908244	missense	possibly damaging	0.80
R7033:Gm12185	UTSW	11	48915999	missense	probably benign
R7512:Gm12185	UTSW	11	48915890	missense	probably benign
R7609:Gm12185	UTSW	11	48916023	missense	possibly damaging	0.82
R7673:Gm12185	UTSW	11	48907628	missense	probably benign	0.45
Z1176:Gm12185	UTSW	11	48908086	missense	not run
Z1177:Gm12185	UTSW	11	48916302	missense	not run

Predicted Primers

PCR Primer
(F):5'- TCTTACTAAAGTAAAGGCCTGAGGC -3'
(R):5'- CTACTGAAGGAACTCCCAGC -3'

Sequencing Primer
(F):5'- GTGGTCCCCCAGTAACACAG -3'
(R):5'- GGAACTCCCAGCCCACAAG -3'

Posted On

2016-06-06