Incidental Mutation 'R5094:Gm12185'
ID387997
Institutional Source Beutler Lab
Gene Symbol Gm12185
Ensembl Gene ENSMUSG00000048852
Gene Namepredicted gene 12185
Synonyms
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48904656-48992226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48907548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 706 (D706V)
Ref Sequence ENSEMBL: ENSMUSP00000092049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
AA Change: D706V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: D706V

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094476
AA Change: D706V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: D706V

DomainStartEndE-ValueType
Pfam:IIGP 27 389 1e-122 PFAM
Pfam:DLIC 43 98 3.2e-5 PFAM
Pfam:MMR_HSR1 63 187 6e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 8.9e-153 PFAM
Pfam:MMR_HSR1 474 615 2.6e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Gm12185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gm12185 APN 11 48907222 missense probably benign 0.01
IGL00495:Gm12185 APN 11 48907861 missense probably damaging 0.99
IGL01763:Gm12185 APN 11 48915844 missense probably benign 0.07
IGL01919:Gm12185 APN 11 48908059 missense possibly damaging 0.90
IGL03388:Gm12185 APN 11 48908286 missense probably benign 0.01
IGL03404:Gm12185 APN 11 48908037 missense probably damaging 1.00
PIT4458001:Gm12185 UTSW 11 48907911 missense probably damaging 1.00
R0347:Gm12185 UTSW 11 48915182 missense probably benign 0.29
R0488:Gm12185 UTSW 11 48907839 missense probably damaging 1.00
R1168:Gm12185 UTSW 11 48915355 missense possibly damaging 0.60
R1223:Gm12185 UTSW 11 48907276 missense probably damaging 0.98
R1417:Gm12185 UTSW 11 48907842 missense probably damaging 1.00
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1519:Gm12185 UTSW 11 48907767 missense probably damaging 1.00
R1558:Gm12185 UTSW 11 48915435 missense probably damaging 0.99
R1630:Gm12185 UTSW 11 48907890 missense probably benign 0.31
R1758:Gm12185 UTSW 11 48908032 missense possibly damaging 0.82
R1793:Gm12185 UTSW 11 48915756 nonsense probably null
R1908:Gm12185 UTSW 11 48915404 missense probably benign 0.00
R1983:Gm12185 UTSW 11 48915356 missense probably benign 0.01
R3917:Gm12185 UTSW 11 48915933 missense probably benign 0.01
R3969:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R3970:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R4510:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4511:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4529:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4529:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4532:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4533:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4533:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4678:Gm12185 UTSW 11 48915540 missense probably benign 0.05
R5238:Gm12185 UTSW 11 48908217 missense possibly damaging 0.92
R5306:Gm12185 UTSW 11 48915555 missense probably benign 0.03
R5371:Gm12185 UTSW 11 48915739 missense probably benign 0.01
R5995:Gm12185 UTSW 11 48915713 missense probably benign 0.40
R6113:Gm12185 UTSW 11 48915340 missense possibly damaging 0.47
R6147:Gm12185 UTSW 11 48915890 missense probably benign
R6160:Gm12185 UTSW 11 48908428 nonsense probably null
R6247:Gm12185 UTSW 11 48915908 missense probably damaging 0.98
R6264:Gm12185 UTSW 11 48916175 missense probably benign 0.01
R6748:Gm12185 UTSW 11 48916296 missense possibly damaging 0.53
R6765:Gm12185 UTSW 11 48915704 missense probably benign 0.12
R6970:Gm12185 UTSW 11 48907912 nonsense probably null
R7028:Gm12185 UTSW 11 48908244 missense possibly damaging 0.80
R7033:Gm12185 UTSW 11 48915999 missense probably benign
R7512:Gm12185 UTSW 11 48915890 missense probably benign
R7609:Gm12185 UTSW 11 48916023 missense possibly damaging 0.82
R7673:Gm12185 UTSW 11 48907628 missense probably benign 0.45
Z1176:Gm12185 UTSW 11 48908086 missense not run
Z1177:Gm12185 UTSW 11 48916302 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTACTAAAGTAAAGGCCTGAGGC -3'
(R):5'- CTACTGAAGGAACTCCCAGC -3'

Sequencing Primer
(F):5'- GTGGTCCCCCAGTAACACAG -3'
(R):5'- GGAACTCCCAGCCCACAAG -3'
Posted On2016-06-06