Incidental Mutation 'R5094:Smtnl2'
ID 387998
Institutional Source Beutler Lab
Gene Symbol Smtnl2
Ensembl Gene ENSMUSG00000045667
Gene Name smoothelin-like 2
Synonyms D130058I21Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R5094 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72389164-72411713 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72400385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 346 (S346C)
Ref Sequence ENSEMBL: ENSMUSP00000059043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050226] [ENSMUST00000108500]
AlphaFold Q8CI12
Predicted Effect probably damaging
Transcript: ENSMUST00000050226
AA Change: S346C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059043
Gene: ENSMUSG00000045667
AA Change: S346C

DomainStartEndE-ValueType
coiled coil region 55 88 N/A INTRINSIC
low complexity region 176 181 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 242 252 N/A INTRINSIC
low complexity region 265 287 N/A INTRINSIC
CH 348 448 3.16e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108500
AA Change: S312C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104140
Gene: ENSMUSG00000045667
AA Change: S312C

DomainStartEndE-ValueType
coiled coil region 21 54 N/A INTRINSIC
low complexity region 142 147 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
CH 314 414 3.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143345
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Smtnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Smtnl2 APN 11 72403259 splice site probably benign
IGL00948:Smtnl2 APN 11 72411241 splice site probably null
IGL01310:Smtnl2 APN 11 72401345 splice site probably null
IGL02277:Smtnl2 APN 11 72391373 missense probably damaging 0.99
R0508:Smtnl2 UTSW 11 72403136 missense probably damaging 1.00
R0784:Smtnl2 UTSW 11 72399937 missense probably damaging 1.00
R1418:Smtnl2 UTSW 11 72401421 missense probably damaging 0.97
R1971:Smtnl2 UTSW 11 72411357 missense probably benign 0.00
R5270:Smtnl2 UTSW 11 72399917 missense probably benign 0.00
R5518:Smtnl2 UTSW 11 72401516 missense possibly damaging 0.95
R5965:Smtnl2 UTSW 11 72400453 splice site probably null
R6213:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6215:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6255:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6257:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6580:Smtnl2 UTSW 11 72403033 missense probably benign 0.12
R7996:Smtnl2 UTSW 11 72400374 missense probably damaging 1.00
R8392:Smtnl2 UTSW 11 72403167 missense probably benign
R9140:Smtnl2 UTSW 11 72399967 missense probably damaging 1.00
R9256:Smtnl2 UTSW 11 72403009 critical splice donor site probably null
Z1176:Smtnl2 UTSW 11 72411711 utr 5 prime probably benign
Z1177:Smtnl2 UTSW 11 72401481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCTTGGATACCACTCAGAAG -3'
(R):5'- CTAGAAAGCTGGGTGTGGCTAG -3'

Sequencing Primer
(F):5'- TTGGATACCACTCAGAAGACCTAAG -3'
(R):5'- CATGGCTGATGGGTGGCAC -3'
Posted On 2016-06-06