Incidental Mutation 'R5094:Tnrc6c'
ID388000
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117721046 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 170 (V170A)
Ref Sequence ENSEMBL: ENSMUSP00000101951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect probably benign
Transcript: ENSMUST00000026658
AA Change: V170A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: V170A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106344
AA Change: V170A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: V170A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138299
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGAAACATTCGGGGTTTTAAGG -3'
(R):5'- TGCCATGACTGCCGTTTGTC -3'

Sequencing Primer
(F):5'- CCCAGGAACTTAGATGTGCTG -3'
(R):5'- CTTCTTCAGGTGGCTCGGGAAG -3'
Posted On2016-06-06