Incidental Mutation 'R5094:Chat'
ID388004
Institutional Source Beutler Lab
Gene Symbol Chat
Ensembl Gene ENSMUSG00000021919
Gene Namecholine acetyltransferase
SynonymsB230380D24Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32408203-32465989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32408939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 582 (I582F)
Ref Sequence ENSEMBL: ENSMUSP00000070865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125]
Predicted Effect probably damaging
Transcript: ENSMUST00000070125
AA Change: I582F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919
AA Change: I582F

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Meta Mutation Damage Score 0.6120 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Chat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Chat APN 14 32449023 missense probably damaging 0.98
IGL01618:Chat APN 14 32446892 splice site probably null
IGL02192:Chat APN 14 32423322 missense possibly damaging 0.94
IGL02418:Chat APN 14 32446949 missense possibly damaging 0.74
IGL02851:Chat APN 14 32458613 missense probably benign
IGL02966:Chat APN 14 32448946 missense probably damaging 1.00
IGL03401:Chat APN 14 32452569 missense probably damaging 1.00
R0511:Chat UTSW 14 32409019 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1729:Chat UTSW 14 32446795 missense probably damaging 1.00
R1782:Chat UTSW 14 32408987 missense probably damaging 1.00
R1972:Chat UTSW 14 32424191 missense probably benign 0.03
R1973:Chat UTSW 14 32424191 missense probably benign 0.03
R2061:Chat UTSW 14 32446873 missense probably benign 0.00
R2270:Chat UTSW 14 32454581 missense probably damaging 0.99
R4012:Chat UTSW 14 32423312 missense possibly damaging 0.56
R4601:Chat UTSW 14 32424155 missense probably benign 0.00
R4620:Chat UTSW 14 32453818 missense probably damaging 1.00
R4760:Chat UTSW 14 32453737 missense probably benign
R4885:Chat UTSW 14 32454610 missense probably damaging 1.00
R4899:Chat UTSW 14 32448977 missense possibly damaging 0.80
R4940:Chat UTSW 14 32419105 missense probably damaging 1.00
R4960:Chat UTSW 14 32420814 missense possibly damaging 0.86
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6621:Chat UTSW 14 32419013 missense probably damaging 0.97
R6648:Chat UTSW 14 32454694 missense probably benign 0.17
R6980:Chat UTSW 14 32424154 missense probably benign 0.15
R7203:Chat UTSW 14 32419057 missense probably damaging 1.00
R7336:Chat UTSW 14 32423256 splice site probably null
R7530:Chat UTSW 14 32408958 nonsense probably null
X0014:Chat UTSW 14 32446933 missense probably benign 0.01
X0066:Chat UTSW 14 32453831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGGCTAGTGGGAGTAGTC -3'
(R):5'- TGTCCAATCATGCATGCCAAC -3'

Sequencing Primer
(F):5'- CTAGTGGGAGTAGTCAAGATTGC -3'
(R):5'- TCTACAGAGTGAGTTTCAGGACAGC -3'
Posted On2016-06-06