Incidental Mutation 'R5094:Mucl1'
ID388006
Institutional Source Beutler Lab
Gene Symbol Mucl1
Ensembl Gene ENSMUSG00000060311
Gene Namemucin-like 1
SynonymsSpt2, Spt-2
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location103751919-103755469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103755403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000154525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078842] [ENSMUST00000226484]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078842
AA Change: S13P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077886
Gene: ENSMUSG00000060311
AA Change: S13P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 76 93 N/A INTRINSIC
internal_repeat_1 98 134 1.67e-5 PROSPERO
internal_repeat_1 134 170 1.67e-5 PROSPERO
low complexity region 187 195 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078842
AA Change: S13P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226484
AA Change: S13P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2093 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Mucl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2338:Mucl1 UTSW 15 103753698 missense possibly damaging 0.66
R2850:Mucl1 UTSW 15 103752082 missense possibly damaging 0.66
R5704:Mucl1 UTSW 15 103755397 missense probably benign 0.05
R7040:Mucl1 UTSW 15 103753578 missense possibly damaging 0.66
R7774:Mucl1 UTSW 15 103753684 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGACCCTGACACCACATG -3'
(R):5'- CCTGTTACACAAATACCAGGTTG -3'

Sequencing Primer
(F):5'- TGACACCACATGGCAGAC -3'
(R):5'- CCAGGTTGTGGCAGCTTC -3'
Posted On2016-06-06