Incidental Mutation 'R5094:Hunk'
ID388007
Institutional Source Beutler Lab
Gene Symbol Hunk
Ensembl Gene ENSMUSG00000053414
Gene Namehormonally upregulated Neu-associated kinase
SynonymsBstk1, Mak-v
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5094 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90386013-90499553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90496666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 612 (D612G)
Ref Sequence ENSEMBL: ENSMUSP00000156104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065856] [ENSMUST00000231719]
Predicted Effect probably benign
Transcript: ENSMUST00000065856
AA Change: D688G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000068007
Gene: ENSMUSG00000053414
AA Change: D688G

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
S_TKc 62 320 8.72e-97 SMART
low complexity region 521 534 N/A INTRINSIC
low complexity region 599 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231719
AA Change: D612G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mutations in this gene result in no abnormal phenotype, however in combination with Tg(MMTV-Myc)Led mice, metastatic potential of mammary tumors is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Hunk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02312:Hunk APN 16 90475941 missense probably damaging 1.00
IGL02850:Hunk APN 16 90432572 missense probably damaging 1.00
R0067:Hunk UTSW 16 90447312 missense probably damaging 1.00
R0436:Hunk UTSW 16 90464154 missense probably damaging 1.00
R1385:Hunk UTSW 16 90472486 missense possibly damaging 0.61
R1392:Hunk UTSW 16 90472464 missense probably damaging 0.99
R1392:Hunk UTSW 16 90472464 missense probably damaging 0.99
R1487:Hunk UTSW 16 90386637 missense probably damaging 0.99
R1707:Hunk UTSW 16 90386407 start gained probably benign
R1781:Hunk UTSW 16 90432560 missense probably damaging 1.00
R2063:Hunk UTSW 16 90493480 missense probably damaging 0.99
R2066:Hunk UTSW 16 90481245 splice site probably null
R2101:Hunk UTSW 16 90432500 splice site probably null
R2144:Hunk UTSW 16 90432532 missense probably damaging 0.99
R2213:Hunk UTSW 16 90432617 missense probably damaging 1.00
R4444:Hunk UTSW 16 90432791 missense probably benign 0.07
R4646:Hunk UTSW 16 90475903 missense probably damaging 0.99
R4661:Hunk UTSW 16 90447308 critical splice acceptor site probably null
R4834:Hunk UTSW 16 90496198 missense probably benign 0.05
R5766:Hunk UTSW 16 90453739 missense probably damaging 1.00
R5809:Hunk UTSW 16 90475903 missense probably damaging 0.99
R6189:Hunk UTSW 16 90487881 missense probably benign
R6194:Hunk UTSW 16 90496395 missense probably damaging 0.99
R6235:Hunk UTSW 16 90432706 missense probably damaging 1.00
R6468:Hunk UTSW 16 90493432 missense possibly damaging 0.88
R6835:Hunk UTSW 16 90472524 missense probably damaging 1.00
R7127:Hunk UTSW 16 90475891 missense probably damaging 0.99
R7329:Hunk UTSW 16 90386682 missense probably benign 0.37
R7331:Hunk UTSW 16 90472562 missense possibly damaging 0.78
R7473:Hunk UTSW 16 90453700 missense probably damaging 1.00
R7719:Hunk UTSW 16 90496666 missense probably benign 0.01
R7827:Hunk UTSW 16 90481326 missense possibly damaging 0.58
R7894:Hunk UTSW 16 90472465 missense probably damaging 1.00
Z1176:Hunk UTSW 16 90472573 missense probably damaging 1.00
Z1177:Hunk UTSW 16 90481321 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTTTTGCCCACGAAGAAAAG -3'
(R):5'- AGCTGATACAAGCGTGGGAC -3'

Sequencing Primer
(F):5'- TTTTGCCCACGAAGAAAAGAACAG -3'
(R):5'- ATAAAGGATGCTCCCGTGAG -3'
Posted On2016-06-06