Incidental Mutation 'R5094:Slc22a6'
ID388008
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Namesolute carrier family 22 (organic anion transporter), member 6
SynonymsNKT, Oat1, mOat1, Orctl1
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5094 (G1)
Quality Score221
Status Validated
Chromosome19
Chromosomal Location8617996-8628299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8626177 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 535 (L535P)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
Predicted Effect probably damaging
Transcript: ENSMUST00000010250
AA Change: L535P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: L535P

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Meta Mutation Damage Score 0.2378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8621868 missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8618357 missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8621208 missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8626214 utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8623616 missense possibly damaging 0.79
R1004:Slc22a6 UTSW 19 8618399 missense probably damaging 1.00
R1775:Slc22a6 UTSW 19 8619107 critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8621882 missense probably benign
R2365:Slc22a6 UTSW 19 8619397 missense probably benign
R3406:Slc22a6 UTSW 19 8621311 missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8618510 missense probably benign
R4693:Slc22a6 UTSW 19 8623652 missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8618553 missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8619422 missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8621784 critical splice acceptor site probably null
R5810:Slc22a6 UTSW 19 8623858 missense probably damaging 1.00
R6176:Slc22a6 UTSW 19 8621797 missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8622130 missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8618441 missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8622096 missense probably benign 0.02
R7298:Slc22a6 UTSW 19 8621320 missense possibly damaging 0.49
R7305:Slc22a6 UTSW 19 8622158 critical splice donor site probably null
R7681:Slc22a6 UTSW 19 8626129 missense probably benign 0.03
R7749:Slc22a6 UTSW 19 8621896 missense possibly damaging 0.48
Z1088:Slc22a6 UTSW 19 8621833 missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8623543 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCTCCAAGTGGAAGATTCTCC -3'
(R):5'- CCTTTGGGGAGGCATTTCTC -3'

Sequencing Primer
(F):5'- TGTCTCTCTGCTCCAGGAAGAAG -3'
(R):5'- CATTTCTCTGAATGGCAGGC -3'
Posted On2016-06-06