Incidental Mutation 'R5094:Ifit3b'
ID 388009
Institutional Source Beutler Lab
Gene Symbol Ifit3b
Ensembl Gene ENSMUSG00000062488
Gene Name interferon-induced protein with tetratricopeptide repeats 3B
Synonyms I830012O16Rik
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5094 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 34607970-34613401 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34612548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 375 (S375T)
Ref Sequence ENSEMBL: ENSMUSP00000075599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076249] [ENSMUST00000087357] [ENSMUST00000112463]
AlphaFold E9PV48
Predicted Effect possibly damaging
Transcript: ENSMUST00000076249
AA Change: S375T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: S375T

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 5e-6 BLAST
TPR 241 274 1.02e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087357
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112463
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Agap3 T C 5: 24,451,321 probably benign Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Ifit3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
Galilee UTSW 19 34611525 missense probably benign
negev UTSW 19 34611460 missense probably benign 0.14
R1528:Ifit3b UTSW 19 34611672 missense probably benign 0.05
R1996:Ifit3b UTSW 19 34611477 missense probably damaging 1.00
R2680:Ifit3b UTSW 19 34612305 missense probably benign 0.01
R2971:Ifit3b UTSW 19 34612017 nonsense probably null
R4395:Ifit3b UTSW 19 34612551 nonsense probably null
R4719:Ifit3b UTSW 19 34612630 missense probably damaging 0.96
R4726:Ifit3b UTSW 19 34611460 missense probably benign 0.14
R5958:Ifit3b UTSW 19 34611742 missense probably benign 0.02
R5987:Ifit3b UTSW 19 34612198 missense probably damaging 1.00
R6381:Ifit3b UTSW 19 34612471 missense probably benign 0.00
R6614:Ifit3b UTSW 19 34611519 missense probably benign 0.01
R6662:Ifit3b UTSW 19 34611937 missense probably damaging 1.00
R6804:Ifit3b UTSW 19 34611547 missense possibly damaging 0.92
R6847:Ifit3b UTSW 19 34611525 missense probably benign
R7685:Ifit3b UTSW 19 34612555 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCATGCAGAAGACTCTTCAGAGG -3'
(R):5'- TTCATGGTGCCAGGAAAAGC -3'

Sequencing Primer
(F):5'- GAGGCGAAGTCCTTTGAACTC -3'
(R):5'- AAGTGTGTTGCCTCCCAAAC -3'
Posted On 2016-06-06