Mutagenetix > Incidental Mutations

Incidental Mutation 'R5094:Ifit3b'

388009

Institutional Source

Beutler Lab

Gene Symbol

Ifit3b

Ensembl Gene

ENSMUSG00000062488

Gene Name

interferon-induced protein with tetratricopeptide repeats 3B

Synonyms

I830012O16Rik

MMRRC Submission

042683-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R5094 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34607970-34613401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34612548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 375 (S375T)

Ref Sequence

ENSEMBL: ENSMUSP00000075599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076249] [ENSMUST00000087357] [ENSMUST00000112463]

AlphaFold

E9PV48

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076249
AA Change: S375T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: S375T

Domain	Start	End	E-Value	Type
TPR	51	84	7.69e1	SMART
TPR	94	127	2.84e1	SMART
TPR	136	169	5.69e0	SMART
Blast:TPR	170	206	5e-6	BLAST
TPR	241	274	1.02e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000087357

SMART Domains

Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297

Domain	Start	End	E-Value	Type
TPR	60	93	2.92e1	SMART
TPR	100	133	6.24e1	SMART
TPR	144	179	4.32e1	SMART
low complexity region	217	230	N/A	INTRINSIC
TPR	249	282	2.24e1	SMART
TPR	334	367	4.55e1	SMART
low complexity region	411	421	N/A	INTRINSIC
TPR	429	462	1.45e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112463

SMART Domains

Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297

Domain	Start	End	E-Value	Type
TPR	60	93	2.92e1	SMART
TPR	100	133	6.24e1	SMART
TPR	144	179	4.32e1	SMART
low complexity region	217	230	N/A	INTRINSIC
TPR	249	282	2.24e1	SMART
TPR	334	367	4.55e1	SMART
low complexity region	411	421	N/A	INTRINSIC
TPR	429	462	1.45e-1	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

91% (40/44)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	G	T	15: 82,062,682	G260V	possibly damaging	Het
Agap3	T	C	5: 24,451,321		probably benign	Het
Bicra	A	G	7: 15,975,371	S1173P	probably damaging	Het
C3	A	T	17: 57,225,033		probably null	Het
Cdh18	G	A	15: 22,714,539		probably benign	Het
Cep290	A	G	10: 100,567,030	K2274E	probably damaging	Het
Cfap54	T	C	10: 92,898,999		probably benign	Het
Chat	T	A	14: 32,408,939	I582F	probably damaging	Het
Chrnb4	T	C	9: 55,035,313	I226V	probably benign	Het
Dnajc2	T	C	5: 21,776,732	T139A	probably damaging	Het
Eml1	T	C	12: 108,536,311	F712S	probably benign	Het
Fgfr1	C	T	8: 25,570,165	S524L	probably damaging	Het
Gimap3	T	C	6: 48,765,372	E208G	probably damaging	Het
Gm12185	T	A	11: 48,907,548	D706V	probably benign	Het
Gucy1a2	T	A	9: 3,865,443	V639D	probably damaging	Het
Hivep2	T	C	10: 14,132,149	F1497S	probably benign	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Mucl1	A	G	15: 103,755,403	S13P	possibly damaging	Het
Olfr1051	T	A	2: 86,276,040	Y149F	probably damaging	Het
Olfr1135	C	T	2: 87,671,830	C179Y	possibly damaging	Het
Pah	T	A	10: 87,538,219	Y78*	probably null	Het
Pex13	A	G	11: 23,655,441	V263A	probably benign	Het
Pfdn2	T	A	1: 171,356,499		probably benign	Het
Phip	C	T	9: 82,871,844	V1616I	probably benign	Het
Pigg	A	G	5: 108,336,257	S457G	possibly damaging	Het
Ppp1r13b	A	G	12: 111,843,610	S97P	probably benign	Het
Slc22a6	T	C	19: 8,626,177	L535P	probably damaging	Het
Slc5a1	A	G	5: 33,158,280	T548A	probably damaging	Het
Smtnl2	T	A	11: 72,400,385	S346C	probably damaging	Het
Spata31d1a	A	G	13: 59,705,044		probably null	Het
Tlcd2	T	C	11: 75,469,814	S228P	probably benign	Het
Tmem135	A	G	7: 89,143,793	L411P	probably damaging	Het
Tnrc6c	T	C	11: 117,721,046	V170A	probably benign	Het

Other mutations in Ifit3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Galilee	UTSW	19	34611525	missense	probably benign
negev	UTSW	19	34611460	missense	probably benign	0.14
R1528:Ifit3b	UTSW	19	34611672	missense	probably benign	0.05
R1996:Ifit3b	UTSW	19	34611477	missense	probably damaging	1.00
R2680:Ifit3b	UTSW	19	34612305	missense	probably benign	0.01
R2971:Ifit3b	UTSW	19	34612017	nonsense	probably null
R4395:Ifit3b	UTSW	19	34612551	nonsense	probably null
R4719:Ifit3b	UTSW	19	34612630	missense	probably damaging	0.96
R4726:Ifit3b	UTSW	19	34611460	missense	probably benign	0.14
R5958:Ifit3b	UTSW	19	34611742	missense	probably benign	0.02
R5987:Ifit3b	UTSW	19	34612198	missense	probably damaging	1.00
R6381:Ifit3b	UTSW	19	34612471	missense	probably benign	0.00
R6614:Ifit3b	UTSW	19	34611519	missense	probably benign	0.01
R6662:Ifit3b	UTSW	19	34611937	missense	probably damaging	1.00
R6804:Ifit3b	UTSW	19	34611547	missense	possibly damaging	0.92
R6847:Ifit3b	UTSW	19	34611525	missense	probably benign
R7685:Ifit3b	UTSW	19	34612555	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCATGCAGAAGACTCTTCAGAGG -3'
(R):5'- TTCATGGTGCCAGGAAAAGC -3'

Sequencing Primer
(F):5'- GAGGCGAAGTCCTTTGAACTC -3'
(R):5'- AAGTGTGTTGCCTCCCAAAC -3'

Posted On

2016-06-06