Mutagenetix > Incidental Mutations

Incidental Mutation 'R0432:Cacna1b'

38801

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

MMRRC Submission

038634-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0432 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24687704 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 719 (T719I)

Ref Sequence

ENSEMBL: ENSMUSP00000037416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447] [ENSMUST00000124183]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041342
AA Change: T719I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: T719I

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000070864
AA Change: T719I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: T719I

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100348
AA Change: T720I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: T720I

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102939
AA Change: T719I

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: T719I

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114447
AA Change: T720I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: T720I

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124183

SMART Domains

Protein: ENSMUSP00000114605
Gene: ENSMUSG00000004113

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	44	60	N/A	INTRINSIC

Meta Mutation Damage Score

0.1184

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.3%
20x: 92.9%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	A	G	17: 35,895,816	L110P	probably damaging	Het
4930522L14Rik	A	T	5: 109,736,919	C358S	probably damaging	Het
9330182L06Rik	G	T	5: 9,440,966	G659*	probably null	Het
Abca8b	C	A	11: 109,980,015	V104F	possibly damaging	Het
Afap1l2	T	C	19: 56,917,119		probably benign	Het
Ahctf1	A	C	1: 179,784,161	I548R	probably damaging	Het
Alox12b	G	T	11: 69,169,556	G646V	probably damaging	Het
Aoah	C	T	13: 20,911,198		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Atxn1l	A	G	8: 109,731,693	W646R	probably damaging	Het
Cabp2	T	C	19: 4,084,903	I28T	possibly damaging	Het
Camk1d	A	T	2: 5,445,135	H70Q	probably damaging	Het
Car1	T	C	3: 14,770,176	T170A	probably benign	Het
Ccdc162	T	C	10: 41,541,860	T2113A	probably benign	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cdh17	T	A	4: 11,771,273	C18*	probably null	Het
Cdk17	A	T	10: 93,237,790		probably benign	Het
Chd9	T	A	8: 90,994,450		probably benign	Het
Chrm5	T	A	2: 112,479,655	K372M	possibly damaging	Het
Clasp2	A	G	9: 113,909,419	T423A	probably benign	Het
Col11a1	A	G	3: 114,205,901		probably benign	Het
Col27a1	T	C	4: 63,225,611	M512T	possibly damaging	Het
Dclk3	A	G	9: 111,484,935	D693G	probably damaging	Het
Dcun1d3	T	A	7: 119,857,950	K180*	probably null	Het
Dmxl2	T	C	9: 54,416,951	R876G	probably benign	Het
Dnmbp	A	T	19: 43,854,857	Y432*	probably null	Het
Eml2	C	T	7: 19,179,531	Q125*	probably null	Het
Faap100	A	C	11: 120,373,876		probably benign	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gda	A	G	19: 21,417,107	Y129H	probably damaging	Het
Gga3	G	A	11: 115,590,524	R207C	probably damaging	Het
Glg1	T	C	8: 111,182,569	I496M	probably damaging	Het
Glt6d1	C	A	2: 25,794,727		probably null	Het
Gm10322	A	T	10: 59,616,208	H49L	possibly damaging	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Gramd3	G	A	18: 56,474,069	C85Y	probably benign	Het
Grhl1	C	T	12: 24,582,919	P153L	probably benign	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hdlbp	T	C	1: 93,425,332	I414V	probably damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Itsn1	T	A	16: 91,815,520	Y266N	probably damaging	Het
Lipe	G	A	7: 25,398,488	P10L	probably benign	Het
Lrrc8a	A	G	2: 30,257,067	E631G	probably damaging	Het
Lvrn	T	A	18: 46,905,299	N973K	possibly damaging	Het
Man2c1	T	A	9: 57,135,597	H250Q	probably damaging	Het
Mup3	T	C	4: 62,085,282	T117A	probably benign	Het
Myo6	A	C	9: 80,273,974		probably benign	Het
Nbn	T	A	4: 15,983,951		probably benign	Het
Ncapg	T	A	5: 45,672,428	N157K	probably damaging	Het
Olfr1024	T	A	2: 85,904,157	N299I	probably damaging	Het
Olfr1137	G	A	2: 87,711,430	H159Y	probably benign	Het
Olfr1154	T	C	2: 87,902,960	T239A	probably damaging	Het
Olfr1178	C	T	2: 88,392,033	T262I	probably damaging	Het
Olfr1434	T	A	19: 12,283,903	M285K	probably damaging	Het
P4ha1	T	A	10: 59,348,257	Y180*	probably null	Het
Pcdhb19	T	A	18: 37,499,535	F794L	probably benign	Het
Pdxdc1	T	A	16: 13,854,400	I379F	probably damaging	Het
Psme3	T	A	11: 101,320,442	S185T	possibly damaging	Het
Ptgr1	A	G	4: 58,978,045	S116P	probably damaging	Het
Ptpn23	A	T	9: 110,389,010		probably null	Het
Rabgap1l	A	C	1: 160,722,205	I277R	probably benign	Het
Rapgef1	C	T	2: 29,679,816	T93I	possibly damaging	Het
Rbp3	A	T	14: 33,954,773	D226V	probably damaging	Het
Rnf144a	A	T	12: 26,339,329	C38S	probably damaging	Het
Rptor	C	T	11: 119,780,553	Q281*	probably null	Het
Rragd	T	C	4: 33,004,332	L208S	probably damaging	Het
Slc12a4	T	C	8: 105,959,488	E41G	probably damaging	Het
Slc16a1	G	T	3: 104,653,419	V347F	probably benign	Het
Slit1	G	A	19: 41,743,293	T39I	probably damaging	Het
Sra1	T	C	18: 36,677,503	N98S	probably benign	Het
Ssx2ip	T	C	3: 146,426,429	L215P	probably damaging	Het
Syne2	A	T	12: 75,949,064	H2126L	probably damaging	Het
Tep1	TTTCTTCTTCTT	TTTCTTCTT	14: 50,866,823		probably benign	Het
Tgfbi	T	C	13: 56,632,191		probably benign	Het
Tmem232	T	C	17: 65,256,503	M632V	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tnnt3	T	G	7: 142,512,086	D153E	probably benign	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Tpsab1	A	G	17: 25,343,824		probably benign	Het
Usp34	T	A	11: 23,401,505	V1431D	probably damaging	Het
Wdr49	G	T	3: 75,450,022	R285S	possibly damaging	Het
Wdr7	A	G	18: 63,796,249	Y1052C	probably damaging	Het
Zan	A	T	5: 137,382,316		probably benign	Het
Zfp652	G	A	11: 95,763,739	V323I	possibly damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zfp874b	A	G	13: 67,481,836	S10P	probably damaging	Het
Zmynd19	A	G	2: 24,958,122	Y110C	probably benign	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	splice site	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	splice site	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4673:Cacna1b	UTSW	2	24631944	missense	probably damaging	1.00
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4795:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6294:Cacna1b	UTSW	2	24719057	missense	possibly damaging	0.94
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7402:Cacna1b	UTSW	2	24607659	missense	probably benign	0.21
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7481:Cacna1b	UTSW	2	24616862	missense	probably damaging	0.99
R7792:Cacna1b	UTSW	2	24677965	missense	probably damaging	0.99
R7999:Cacna1b	UTSW	2	24650626	missense	probably damaging	1.00
R8041:Cacna1b	UTSW	2	24657299	missense	probably damaging	1.00
R8084:Cacna1b	UTSW	2	24685796	missense	probably benign	0.21
R8147:Cacna1b	UTSW	2	24679176	missense	probably damaging	0.97
R8170:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R8371:Cacna1b	UTSW	2	24720024	missense	possibly damaging	0.46
R8391:Cacna1b	UTSW	2	24706200	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00
Z1176:Cacna1b	UTSW	2	24626884	nonsense	probably null
Z1177:Cacna1b	UTSW	2	24638677	missense	probably damaging	0.98
Z1177:Cacna1b	UTSW	2	24661790	missense	probably damaging	1.00
Z1177:Cacna1b	UTSW	2	24678988	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAATGGTCTCTGCTGGGTACTTCC -3'
(R):5'- TTGTACATCTGGGTACACCAGGGC -3'

Sequencing Primer
(F):5'- GGCAATTCTCTGTATCCAGAAC -3'
(R):5'- GGATAGAGGCTGGACACTTG -3'

Posted On

2013-05-23