Incidental Mutation 'R5096:Smc4'
ID388027
Institutional Source Beutler Lab
Gene Symbol Smc4
Ensembl Gene ENSMUSG00000034349
Gene Namestructural maintenance of chromosomes 4
Synonyms2500002A22Rik, Smc4l1
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69004738-69034623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69021279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 412 (I412K)
Ref Sequence ENSEMBL: ENSMUSP00000103433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000136502] [ENSMUST00000148385] [ENSMUST00000195525]
Predicted Effect probably damaging
Transcript: ENSMUST00000042901
AA Change: I437K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349
AA Change: I437K

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107803
AA Change: I412K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349
AA Change: I412K

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128134
Predicted Effect probably benign
Transcript: ENSMUST00000136502
SMART Domains Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:SMC_N 81 303 1.2e-42 PFAM
Pfam:AAA_23 84 336 2.6e-16 PFAM
Pfam:AAA_21 106 227 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148385
Predicted Effect probably benign
Transcript: ENSMUST00000149174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194693
Predicted Effect probably benign
Transcript: ENSMUST00000195525
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Smc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Smc4 APN 3 69030379 missense probably damaging 0.98
IGL00542:Smc4 APN 3 69028438 splice site probably benign
IGL01104:Smc4 APN 3 69027584 missense possibly damaging 0.95
IGL01380:Smc4 APN 3 69025828 missense probably damaging 1.00
IGL01397:Smc4 APN 3 69031544 missense probably benign
IGL02441:Smc4 APN 3 69006211 missense probably damaging 1.00
IGL02629:Smc4 APN 3 69025873 missense probably damaging 0.96
IGL03220:Smc4 APN 3 69009542 missense possibly damaging 0.67
pyrrhic UTSW 3 69027502 missense probably damaging 1.00
R0452:Smc4 UTSW 3 69008028 nonsense probably null
R0523:Smc4 UTSW 3 69025888 missense probably damaging 1.00
R0568:Smc4 UTSW 3 69022461 critical splice donor site probably null
R0571:Smc4 UTSW 3 69024289 missense probably damaging 1.00
R0602:Smc4 UTSW 3 69009538 missense probably damaging 1.00
R0925:Smc4 UTSW 3 69006215 critical splice donor site probably benign
R0963:Smc4 UTSW 3 69025926 missense probably damaging 1.00
R1540:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R1755:Smc4 UTSW 3 69034108 missense probably damaging 1.00
R1920:Smc4 UTSW 3 69033068 missense probably damaging 1.00
R4226:Smc4 UTSW 3 69031467 missense probably benign 0.01
R4510:Smc4 UTSW 3 69016647 splice site probably null
R4511:Smc4 UTSW 3 69016647 splice site probably null
R4899:Smc4 UTSW 3 69031811 missense probably damaging 0.97
R4967:Smc4 UTSW 3 69018239 intron probably benign
R5101:Smc4 UTSW 3 69028512 missense probably benign 0.00
R5588:Smc4 UTSW 3 69025857 missense probably benign
R5631:Smc4 UTSW 3 69030312 missense probably benign 0.16
R5633:Smc4 UTSW 3 69008110 missense probably damaging 1.00
R6229:Smc4 UTSW 3 69030247 nonsense probably null
R6300:Smc4 UTSW 3 69027891 missense probably benign 0.00
R6554:Smc4 UTSW 3 69029515 missense probably benign 0.00
R6596:Smc4 UTSW 3 69025893 missense probably damaging 1.00
R6603:Smc4 UTSW 3 69022461 critical splice donor site probably null
R6682:Smc4 UTSW 3 69007241 missense probably damaging 0.98
R6727:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R6955:Smc4 UTSW 3 69024309 missense possibly damaging 0.95
R7037:Smc4 UTSW 3 69018195 missense possibly damaging 0.67
R7051:Smc4 UTSW 3 69027502 missense probably damaging 1.00
R7454:Smc4 UTSW 3 69018124 missense probably benign
R7630:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7632:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7633:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
X0063:Smc4 UTSW 3 69018103 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTCAGCTATCTGGAGTCTTGTC -3'
(R):5'- AGACATGTAGTATTGCACTAGGC -3'

Sequencing Primer
(F):5'- TATTGAGTACCCTCCAGC -3'
(R):5'- TCAGAAGCTCACCTTTGAATGC -3'
Posted On2016-06-06