Incidental Mutation 'R5096:Adar'
ID388028
Institutional Source Beutler Lab
Gene Symbol Adar
Ensembl Gene ENSMUSG00000027951
Gene Nameadenosine deaminase, RNA-specific
SynonymsAdar1p150, ADAR1, mZaADAR, Adar1p110
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5096 (G1)
Quality Score216
Status Validated
Chromosome3
Chromosomal Location89715022-89753446 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 89747291 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 728 (*728C)
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029563] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000118341] [ENSMUST00000121094] [ENSMUST00000200558]
Predicted Effect probably damaging
Transcript: ENSMUST00000029563
AA Change: I884N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029563
Gene: ENSMUSG00000027951
AA Change: I884N

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
ADEAMc 762 1145 3.74e-205 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098924
AA Change: I662N

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951
AA Change: I662N

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107405
AA Change: I910N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951
AA Change: I910N

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118341
AA Change: I392N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113453
Gene: ENSMUSG00000027951
AA Change: I392N

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
low complexity region 245 256 N/A INTRINSIC
ADEAMc 270 653 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121094
AA Change: I366N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112969
Gene: ENSMUSG00000027951
AA Change: I366N

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
ADEAMc 244 627 3.74e-205 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131030
Predicted Effect probably null
Transcript: ENSMUST00000200558
AA Change: *728C
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950
AA Change: *728C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die during gestation. Inactivation of this locus has been associated with increased apoptosis and, in some lines, defects in both primitive and definitive hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Adar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Adar APN 3 89730840 critical splice donor site probably null
IGL01743:Adar APN 3 89745440 nonsense probably null
IGL01982:Adar APN 3 89738090 missense probably benign 0.03
logimen UTSW 3 89730814 missense probably benign 0.04
R0153:Adar UTSW 3 89730814 missense probably benign 0.04
R0464:Adar UTSW 3 89735582 missense possibly damaging 0.90
R0674:Adar UTSW 3 89749823 intron probably benign
R0762:Adar UTSW 3 89739983 splice site probably benign
R1567:Adar UTSW 3 89735781 missense probably benign 0.19
R1807:Adar UTSW 3 89734865 missense probably benign 0.00
R1858:Adar UTSW 3 89739282 missense probably benign 0.01
R1964:Adar UTSW 3 89745895 missense probably benign 0.23
R2440:Adar UTSW 3 89734854 missense possibly damaging 0.86
R3731:Adar UTSW 3 89746655 missense probably damaging 0.99
R3854:Adar UTSW 3 89736258 missense probably damaging 1.00
R4005:Adar UTSW 3 89749787 missense probably damaging 1.00
R4105:Adar UTSW 3 89740094 missense probably benign 0.00
R4693:Adar UTSW 3 89735940 missense probably damaging 1.00
R4980:Adar UTSW 3 89730814 missense probably benign 0.04
R5199:Adar UTSW 3 89745944 missense probably damaging 1.00
R5397:Adar UTSW 3 89735319 missense probably benign
R5406:Adar UTSW 3 89736111 missense probably damaging 1.00
R5411:Adar UTSW 3 89739212 missense probably benign 0.39
R5446:Adar UTSW 3 89740179 missense probably damaging 1.00
R5660:Adar UTSW 3 89735594 missense probably damaging 1.00
R5724:Adar UTSW 3 89735169 missense probably benign
R6087:Adar UTSW 3 89745590 missense probably benign 0.05
R6935:Adar UTSW 3 89747218 missense probably benign 0.00
R7644:Adar UTSW 3 89745519 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTACCGTGGAAGCCTTC -3'
(R):5'- CCATTTGCCATCAATGCCAAG -3'

Sequencing Primer
(F):5'- TTTCCTTGGCTCCAGCAGGG -3'
(R):5'- CCAAGGGCATTTTCTTAATCCTATG -3'
Posted On2016-06-06