Mutagenetix > Incidental Mutation

Incidental Mutation 'R5096:Mmp17'

388038

Institutional Source

Beutler Lab

Gene Symbol

Mmp17

Ensembl Gene

ENSMUSG00000029436

Gene Name

matrix metallopeptidase 17

Synonyms

membrane type-4 matrix metalloproteinase, MT4-MMP

MMRRC Submission

042685-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R5096 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129584169-129611099 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 129605563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 422 (P422Q)

Ref Sequence

ENSEMBL: ENSMUSP00000031390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031390]

AlphaFold

Q9R0S3

Predicted Effect

probably damaging
Transcript: ENSMUST00000031390
AA Change: P422Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: P422Q

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
Pfam:PG_binding_1	44	104	5e-15	PFAM
ZnMc	128	295	8.26e-47	SMART
low complexity region	308	320	N/A	INTRINSIC
HX	340	384	3.17e-8	SMART
HX	389	432	2.59e-13	SMART
HX	435	481	6.39e-13	SMART
HX	483	527	1.1e-7	SMART
low complexity region	563	578	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177802

Meta Mutation Damage Score

0.8662

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	A	T	14: 54,679,222		probably benign	Het
Adar	T	A	3: 89,747,291	*728C	probably null	Het
Ap3b1	A	G	13: 94,479,849	R753G	unknown	Het
Atp9b	C	T	18: 80,762,184	V720I	probably benign	Het
AY358078	A	C	14: 51,826,118	D407A	probably benign	Het
Ccdc185	A	G	1: 182,748,789	S112P	possibly damaging	Het
Cir1	A	G	2: 73,303,761	S155P	probably damaging	Het
Colq	C	T	14: 31,552,954	E76K	possibly damaging	Het
Cthrc1	T	A	15: 39,084,420	I104N	probably damaging	Het
D930020B18Rik	A	T	10: 121,667,804	I92L	probably benign	Het
Eif3i	C	T	4: 129,600,444	E21K	probably damaging	Het
Fam114a1	T	A	5: 64,979,891	M59K	probably benign	Het
Fam163b	A	G	2: 27,112,749	S79P	probably benign	Het
Fam181b	T	G	7: 93,081,245		probably benign	Het
Fsip2	G	A	2: 82,991,116	S5731N	probably benign	Het
Fzd9	C	T	5: 135,249,859	V391I	probably damaging	Het
Gbp5	A	G	3: 142,501,361	D97G	probably damaging	Het
Gm10715	T	C	9: 3,038,157		probably benign	Het
Grhl1	A	T	12: 24,603,050	K418M	probably damaging	Het
H2-Q4	T	A	17: 35,379,713		probably benign	Het
Hmcn1	C	A	1: 150,610,669	A4329S	probably damaging	Het
Hspa8	T	C	9: 40,802,901		probably benign	Het
Ica1l	T	C	1: 60,028,154	T26A	possibly damaging	Het
Ifi209	T	A	1: 173,644,734	N380K	probably benign	Het
Inpp5e	G	T	2: 26,399,525	N482K	probably damaging	Het
Iqsec3	C	T	6: 121,386,698	V866M	probably damaging	Het
Kbtbd2	A	G	6: 56,779,275	V492A	probably benign	Het
Kcnb2	A	G	1: 15,710,844	R647G	probably benign	Het
Lcmt1	T	G	7: 123,401,468	V75G	probably damaging	Het
Lrp4	A	G	2: 91,485,792	I752V	possibly damaging	Het
Myo3a	A	T	2: 22,574,242	H165L	probably benign	Het
Nos3	C	T	5: 24,371,957	T494I	probably damaging	Het
Olfr1184	C	T	2: 88,487,302	T190I	possibly damaging	Het
Olfr356	T	C	2: 36,937,803	V228A	possibly damaging	Het
Olfr52	A	G	2: 86,181,932	Y60H	probably damaging	Het
Olfr638	T	C	7: 104,003,460	Y68H	probably benign	Het
Pkn2	A	C	3: 142,839,331	V27G	probably damaging	Het
Scube2	T	C	7: 109,799,244		probably benign	Het
Skint7	A	G	4: 111,981,955	I149V	probably damaging	Het
Smc4	T	A	3: 69,021,279	I412K	probably damaging	Het
Snx19	T	A	9: 30,428,786	C407S	probably benign	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Sytl2	T	A	7: 90,376,082	I426N	possibly damaging	Het
Tbce	A	T	13: 14,029,405		probably benign	Het
Tdpoz2	T	C	3: 93,652,512	E51G	possibly damaging	Het
Tmem221	A	G	8: 71,558,709	L34P	probably damaging	Het
Tmem92	T	C	11: 94,779,036	T90A	probably benign	Het
Tpr	A	G	1: 150,446,202	D42G	probably damaging	Het
Wt1	A	G	2: 105,143,125	T237A	probably damaging	Het

Other mutations in Mmp17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Mmp17	APN	5	129606408	missense	probably benign	0.00
IGL01602:Mmp17	APN	5	129601944	missense	probably benign	0.00
IGL01605:Mmp17	APN	5	129601944	missense	probably benign	0.00
IGL01782:Mmp17	APN	5	129602141	missense	probably damaging	1.00
IGL01986:Mmp17	APN	5	129596628	missense	probably damaging	1.00
IGL02096:Mmp17	APN	5	129598688	nonsense	probably null
IGL02160:Mmp17	APN	5	129595569	missense	possibly damaging	0.91
IGL03075:Mmp17	APN	5	129595074	missense	probably damaging	1.00
P0005:Mmp17	UTSW	5	129596631	missense	probably benign	0.00
R0125:Mmp17	UTSW	5	129594582	missense	possibly damaging	0.88
R0553:Mmp17	UTSW	5	129598670	missense	probably benign	0.30
R1521:Mmp17	UTSW	5	129595088	splice site	probably null
R1938:Mmp17	UTSW	5	129602126	missense	probably damaging	1.00
R2151:Mmp17	UTSW	5	129605661	missense	probably benign	0.01
R4908:Mmp17	UTSW	5	129605666	nonsense	probably null
R4970:Mmp17	UTSW	5	129602165	missense	possibly damaging	0.51
R5112:Mmp17	UTSW	5	129602165	missense	possibly damaging	0.51
R5178:Mmp17	UTSW	5	129595058	missense	probably damaging	1.00
R5304:Mmp17	UTSW	5	129594614	missense	probably null	0.89
R5341:Mmp17	UTSW	5	129602129	missense	possibly damaging	0.50
R6341:Mmp17	UTSW	5	129601955	missense	probably damaging	0.99
R6501:Mmp17	UTSW	5	129606405	missense	probably benign	0.00
R7257:Mmp17	UTSW	5	129595633	missense	probably benign	0.03
R7371:Mmp17	UTSW	5	129605772	missense	probably null	0.98
R7546:Mmp17	UTSW	5	129596589	missense	probably damaging	1.00
R8026:Mmp17	UTSW	5	129595084	critical splice donor site	probably null
R8370:Mmp17	UTSW	5	129605578	missense	probably damaging	1.00
R8525:Mmp17	UTSW	5	129602207	missense	probably damaging	1.00
R8708:Mmp17	UTSW	5	129595422	missense	possibly damaging	0.67
R8803:Mmp17	UTSW	5	129598709	nonsense	probably null
R8878:Mmp17	UTSW	5	129606314	missense	probably damaging	1.00
R8882:Mmp17	UTSW	5	129601944	missense	probably benign	0.00
R9399:Mmp17	UTSW	5	129594622	nonsense	probably null
R9404:Mmp17	UTSW	5	129605677	missense	possibly damaging	0.89
R9528:Mmp17	UTSW	5	129606328	missense	probably benign	0.00
W0251:Mmp17	UTSW	5	129595527	missense	probably benign	0.09
Y5377:Mmp17	UTSW	5	129595530	missense	probably damaging	1.00
Y5380:Mmp17	UTSW	5	129595530	missense	probably damaging	1.00
Z1177:Mmp17	UTSW	5	129595661	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACCCGATTCTCAGGCATTG -3'
(R):5'- ATCCAACATGCTGGGGACAC -3'

Sequencing Primer
(F):5'- GGTGCTCAATCAATGTCAGACGC -3'
(R):5'- AACATGCTGGGGACACCTCTC -3'

Posted On

2016-06-06