Incidental Mutation 'R5096:Sytl2'
ID388041
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90376082 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 426 (I426N)
Ref Sequence ENSEMBL: ENSMUSP00000147191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000207578] [ENSMUST00000208720]
Predicted Effect probably benign
Transcript: ENSMUST00000107210
AA Change: I426N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: I426N

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107211
AA Change: I426N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616
AA Change: I426N

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190731
AA Change: I426N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: I426N

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190837
AA Change: I399N

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: I399N

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207455
Predicted Effect probably benign
Transcript: ENSMUST00000207578
Predicted Effect possibly damaging
Transcript: ENSMUST00000208720
AA Change: I426N

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTCCTAGACCCGTCCTTG -3'
(R):5'- GATCATTTCACCAGCTTGTCTG -3'

Sequencing Primer
(F):5'- CTGTTTTAGAATCTGACCAGTTGC -3'
(R):5'- GGTGAAGCCAGCTTTTGTAACC -3'
Posted On2016-06-06