Incidental Mutation 'R5096:Scube2'
ID 388044
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R5096 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to C at 109799244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably benign
Transcript: ENSMUST00000007423
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138946
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGTCCACATCTGAAATG -3'
(R):5'- AAGATTTGAGTGTCTTGGCCC -3'

Sequencing Primer
(F):5'- CAGTCCACATCTGAAATGTTGGG -3'
(R):5'- GAGTGTCTTGGCCCCATAAC -3'
Posted On 2016-06-06