Incidental Mutation 'R5096:Snx19'
ID 388047
Institutional Source Beutler Lab
Gene Symbol Snx19
Ensembl Gene ENSMUSG00000031993
Gene Name sorting nexin 19
Synonyms 3526401K03Rik
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R5096 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 30427108-30466733 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30428786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 407 (C407S)
Ref Sequence ENSEMBL: ENSMUSP00000131895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164099]
AlphaFold Q6P4T1
Predicted Effect probably benign
Transcript: ENSMUST00000164099
AA Change: C407S

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: C407S

DomainStartEndE-ValueType
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:PXA 96 269 2.9e-43 PFAM
low complexity region 324 335 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 504 528 N/A INTRINSIC
PX 533 664 1.83e-24 SMART
Pfam:Nexin_C 843 951 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217174
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Snx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Snx19 APN 9 30429084 missense possibly damaging 0.92
IGL00498:Snx19 APN 9 30428937 missense possibly damaging 0.92
IGL00718:Snx19 APN 9 30432326 missense probably damaging 1.00
IGL00902:Snx19 APN 9 30428732 missense possibly damaging 0.90
IGL01433:Snx19 APN 9 30428771 missense possibly damaging 0.93
IGL01668:Snx19 APN 9 30427823 missense probably benign
IGL01732:Snx19 APN 9 30462353 missense probably damaging 1.00
IGL01767:Snx19 APN 9 30463264 missense possibly damaging 0.95
IGL02638:Snx19 APN 9 30432364 missense possibly damaging 0.52
IGL02718:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02719:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02723:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02724:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02725:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02892:Snx19 APN 9 30428364 missense probably damaging 1.00
IGL03061:Snx19 APN 9 30433632 missense probably damaging 0.99
IGL03402:Snx19 APN 9 30440134 missense possibly damaging 0.89
R0125:Snx19 UTSW 9 30440219 missense probably damaging 1.00
R0133:Snx19 UTSW 9 30428616 missense possibly damaging 0.94
R0196:Snx19 UTSW 9 30433387 missense probably damaging 1.00
R0423:Snx19 UTSW 9 30435837 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428810 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428811 missense probably damaging 1.00
R1068:Snx19 UTSW 9 30429018 missense probably damaging 0.99
R1570:Snx19 UTSW 9 30428343 missense probably damaging 1.00
R1727:Snx19 UTSW 9 30433366 missense probably damaging 1.00
R1895:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1907:Snx19 UTSW 9 30433576 missense probably damaging 0.99
R1946:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1989:Snx19 UTSW 9 30428108 missense possibly damaging 0.93
R2029:Snx19 UTSW 9 30429000 missense probably benign 0.01
R2914:Snx19 UTSW 9 30433532 unclassified probably benign
R3880:Snx19 UTSW 9 30462392 missense probably damaging 1.00
R4223:Snx19 UTSW 9 30428448 missense possibly damaging 0.95
R4415:Snx19 UTSW 9 30437483 missense probably damaging 0.99
R4438:Snx19 UTSW 9 30428599 missense probably benign 0.01
R4484:Snx19 UTSW 9 30427896 missense probably benign 0.01
R4585:Snx19 UTSW 9 30440195 missense probably damaging 1.00
R4765:Snx19 UTSW 9 30440157 missense probably damaging 1.00
R4771:Snx19 UTSW 9 30433638 missense probably damaging 1.00
R4922:Snx19 UTSW 9 30437467 missense probably benign 0.25
R5464:Snx19 UTSW 9 30427973 missense possibly damaging 0.54
R6469:Snx19 UTSW 9 30427743 missense possibly damaging 0.50
R6886:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R6988:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R7131:Snx19 UTSW 9 30427893 missense probably damaging 1.00
R7268:Snx19 UTSW 9 30440177 missense probably damaging 1.00
R7772:Snx19 UTSW 9 30428925 missense probably damaging 0.99
R8087:Snx19 UTSW 9 30464402 missense probably benign
R8211:Snx19 UTSW 9 30437465 missense probably benign
R8283:Snx19 UTSW 9 30463226 missense possibly damaging 0.56
R9000:Snx19 UTSW 9 30464323 missense unknown
R9383:Snx19 UTSW 9 30435900 missense probably damaging 1.00
R9436:Snx19 UTSW 9 30463306 missense possibly damaging 0.55
X0019:Snx19 UTSW 9 30437366 missense probably damaging 1.00
X0024:Snx19 UTSW 9 30427721 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGCTGTAGAGGGAGATTTGCC -3'
(R):5'- GCTGTAAGAGAGGTGTCATCTCC -3'

Sequencing Primer
(F):5'- TGCCTGGGATGCTCGAAG -3'
(R):5'- AAGAGAGGTGTCATCTCCTTGCTC -3'
Posted On 2016-06-06