Mutagenetix > Incidental Mutation

Incidental Mutation 'R5096:Ap3b1'

388051

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

042685-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R5096 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94479849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 753 (R753G)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

unknown
Transcript: ENSMUST00000022196
AA Change: R753G

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R753G

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000231916
AA Change: R118G

Meta Mutation Damage Score

0.0766

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	A	T	14: 54,679,222		probably benign	Het
Adar	T	A	3: 89,747,291	*728C	probably null	Het
Atp9b	C	T	18: 80,762,184	V720I	probably benign	Het
AY358078	A	C	14: 51,826,118	D407A	probably benign	Het
Ccdc185	A	G	1: 182,748,789	S112P	possibly damaging	Het
Cir1	A	G	2: 73,303,761	S155P	probably damaging	Het
Colq	C	T	14: 31,552,954	E76K	possibly damaging	Het
Cthrc1	T	A	15: 39,084,420	I104N	probably damaging	Het
D930020B18Rik	A	T	10: 121,667,804	I92L	probably benign	Het
Eif3i	C	T	4: 129,600,444	E21K	probably damaging	Het
Fam114a1	T	A	5: 64,979,891	M59K	probably benign	Het
Fam163b	A	G	2: 27,112,749	S79P	probably benign	Het
Fam181b	T	G	7: 93,081,245		probably benign	Het
Fsip2	G	A	2: 82,991,116	S5731N	probably benign	Het
Fzd9	C	T	5: 135,249,859	V391I	probably damaging	Het
Gbp5	A	G	3: 142,501,361	D97G	probably damaging	Het
Gm10715	T	C	9: 3,038,157		probably benign	Het
Grhl1	A	T	12: 24,603,050	K418M	probably damaging	Het
H2-Q4	T	A	17: 35,379,713		probably benign	Het
Hmcn1	C	A	1: 150,610,669	A4329S	probably damaging	Het
Hspa8	T	C	9: 40,802,901		probably benign	Het
Ica1l	T	C	1: 60,028,154	T26A	possibly damaging	Het
Ifi209	T	A	1: 173,644,734	N380K	probably benign	Het
Inpp5e	G	T	2: 26,399,525	N482K	probably damaging	Het
Iqsec3	C	T	6: 121,386,698	V866M	probably damaging	Het
Kbtbd2	A	G	6: 56,779,275	V492A	probably benign	Het
Kcnb2	A	G	1: 15,710,844	R647G	probably benign	Het
Lcmt1	T	G	7: 123,401,468	V75G	probably damaging	Het
Lrp4	A	G	2: 91,485,792	I752V	possibly damaging	Het
Mmp17	C	A	5: 129,605,563	P422Q	probably damaging	Het
Myo3a	A	T	2: 22,574,242	H165L	probably benign	Het
Nos3	C	T	5: 24,371,957	T494I	probably damaging	Het
Olfr1184	C	T	2: 88,487,302	T190I	possibly damaging	Het
Olfr356	T	C	2: 36,937,803	V228A	possibly damaging	Het
Olfr52	A	G	2: 86,181,932	Y60H	probably damaging	Het
Olfr638	T	C	7: 104,003,460	Y68H	probably benign	Het
Pkn2	A	C	3: 142,839,331	V27G	probably damaging	Het
Scube2	T	C	7: 109,799,244		probably benign	Het
Skint7	A	G	4: 111,981,955	I149V	probably damaging	Het
Smc4	T	A	3: 69,021,279	I412K	probably damaging	Het
Snx19	T	A	9: 30,428,786	C407S	probably benign	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Sytl2	T	A	7: 90,376,082	I426N	possibly damaging	Het
Tbce	A	T	13: 14,029,405		probably benign	Het
Tdpoz2	T	C	3: 93,652,512	E51G	possibly damaging	Het
Tmem221	A	G	8: 71,558,709	L34P	probably damaging	Het
Tmem92	T	C	11: 94,779,036	T90A	probably benign	Het
Tpr	A	G	1: 150,446,202	D42G	probably damaging	Het
Wt1	A	G	2: 105,143,125	T237A	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCCATCTAAGTCAGTACC -3'
(R):5'- TGAACCCTAAGATCTGCTCAC -3'

Sequencing Primer
(F):5'- CTGTGGGTCCTACACGTAGTTAAATG -3'
(R):5'- GATCTGCTCACGTTCAAAATAAAAC -3'

Posted On

2016-06-06