Incidental Mutation 'R5096:Cthrc1'
ID388055
Institutional Source Beutler Lab
Gene Symbol Cthrc1
Ensembl Gene ENSMUSG00000054196
Gene Namecollagen triple helix repeat containing 1
Synonyms1110014B07Rik
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39076932-39087121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39084420 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 104 (I104N)
Ref Sequence ENSEMBL: ENSMUSP00000153886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067072] [ENSMUST00000226433]
Predicted Effect probably damaging
Transcript: ENSMUST00000067072
AA Change: I178N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070018
Gene: ENSMUSG00000054196
AA Change: I178N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144800
Predicted Effect probably damaging
Transcript: ENSMUST00000226433
AA Change: I104N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.4766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Adult mice homozygous for a null allele exhibit decreased bone, decreased osteoblast number and decreased bone formation. Mice homozygous for a different knock-out allele exhibit increased hepatocyte size, decreased cell density in the liver, hepatic steatosis and increased glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Cthrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cthrc1 APN 15 39080499 missense possibly damaging 0.95
IGL02532:Cthrc1 APN 15 39077165 splice site probably benign
IGL02954:Cthrc1 APN 15 39076994 utr 5 prime probably benign
IGL03390:Cthrc1 APN 15 39077134 missense probably benign 0.00
R0390:Cthrc1 UTSW 15 39086764 makesense probably null
R0594:Cthrc1 UTSW 15 39077142 missense possibly damaging 0.95
R1491:Cthrc1 UTSW 15 39086677 missense probably damaging 1.00
R4454:Cthrc1 UTSW 15 39077013 missense probably benign 0.18
R5860:Cthrc1 UTSW 15 39086685 missense probably damaging 1.00
R7082:Cthrc1 UTSW 15 39077100 missense probably benign
R7717:Cthrc1 UTSW 15 39077116 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGCACAGGTTAGATGGG -3'
(R):5'- CAGCTAGAGGACTATGGACCAG -3'

Sequencing Primer
(F):5'- ATCAGTGGAGTCTCAAAGGCCTC -3'
(R):5'- GGACCAGCTAGAGGTTTATTTCTAAC -3'
Posted On2016-06-06