Incidental Mutation 'R5097:Adgrb3'
ID388058
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25826084 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 226 (T226M)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: T226M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: T226M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: T226M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: T226M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146592
AA Change: T19M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: T19M

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: T226M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: T226M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195754
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25221757 splice site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25826391 missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25226754 missense probably benign 0.01
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAAGTCACTTCAAAGTTGACAGG -3'
(R):5'- TACTGAACAAGGTGAGCCCG -3'

Sequencing Primer
(F):5'- TCACTTCAAAGTTGACAGGATAAAGG -3'
(R):5'- TGAGCCCGAGCCAGTTTG -3'
Posted On2016-06-06