Incidental Mutation 'R5097:Ndc1'
ID388071
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene NameNDC1 transmembrane nucleoporin
Synonymssks, Tmem48, 2810475A17Rik
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107367784-107416346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107374161 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 100 (S100T)
Ref Sequence ENSEMBL: ENSMUSP00000137180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably benign
Transcript: ENSMUST00000139560
AA Change: S100T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: S100T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149366
AA Change: S100T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: S100T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107384780 splice site probably benign
IGL00929:Ndc1 APN 4 107389497 missense probably benign 0.23
IGL01340:Ndc1 APN 4 107374147 missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107375197 missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107395804 missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107394995 splice site probably benign
IGL03251:Ndc1 APN 4 107380659 missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107395812 missense probably benign 0.02
R1541:Ndc1 UTSW 4 107371288 nonsense probably null
R1605:Ndc1 UTSW 4 107368096 missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107395068 splice site probably benign
R1716:Ndc1 UTSW 4 107384795 missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107393158 missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107411072 missense probably benign 0.22
R4698:Ndc1 UTSW 4 107411137 missense probably benign 0.06
R4794:Ndc1 UTSW 4 107390222 missense probably benign 0.03
R5053:Ndc1 UTSW 4 107374218 missense probably damaging 1.00
R5158:Ndc1 UTSW 4 107375165 missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107389576 missense probably benign
R5579:Ndc1 UTSW 4 107380704 missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107389526 missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107383707 missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107411198 missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107368107 missense probably benign 0.01
R8065:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8067:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8100:Ndc1 UTSW 4 107383605 missense possibly damaging 0.94
Z1176:Ndc1 UTSW 4 107386602 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCAAGGCCCTATCTCG -3'
(R):5'- ACCTGGTAAATAACAGGCTTTCTAG -3'

Sequencing Primer
(F):5'- AAGGCCCTATCTCGATTCTCTAGG -3'
(R):5'- AAGAAGAAAACTTGACCATACCTCTC -3'
Posted On2016-06-06