Incidental Mutation 'R5097:Adamts3'
ID 388075
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5097 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89693050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 805 (V805F)
Ref Sequence ENSEMBL: ENSMUSP00000058552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: V805F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: V805F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163159
AA Change: V806F

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: V806F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956 missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8827:Adamts3 UTSW 5 89691465 missense probably benign 0.03
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9005:Adamts3 UTSW 5 89677834 missense probably benign 0.08
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9505:Adamts3 UTSW 5 89707892 missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTTCCCCATACAGAAGGC -3'
(R):5'- CTACGAGTCATGAGCACTGC -3'

Sequencing Primer
(F):5'- GGATTTCTGAGTTCAAGGCCAACC -3'
(R):5'- CACTGCCATATAATAAATGTGTGCCC -3'
Posted On 2016-06-06