Incidental Mutation 'R5097:Mtus2'
ID388077
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148295582 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 146 (V146I)
Ref Sequence ENSEMBL: ENSMUSP00000071775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071878] [ENSMUST00000085558] [ENSMUST00000110514] [ENSMUST00000110515] [ENSMUST00000146425]
Predicted Effect probably damaging
Transcript: ENSMUST00000071878
AA Change: V146I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071775
Gene: ENSMUSG00000029651
AA Change: V146I

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085558
AA Change: V1151I

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: V1151I

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110514
AA Change: V146I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106143
Gene: ENSMUSG00000029651
AA Change: V146I

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 281 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110515
AA Change: V146I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106144
Gene: ENSMUSG00000029651
AA Change: V146I

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 314 N/A INTRINSIC
low complexity region 327 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146425
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1253:Mtus2 UTSW 5 148303570 nonsense probably null
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R2327:Mtus2 UTSW 5 148077915 missense probably benign 0.00
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4396:Mtus2 UTSW 5 148203938 missense possibly damaging 0.81
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5388:Mtus2 UTSW 5 148306708 nonsense probably null
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6009:Mtus2 UTSW 5 148306652 missense probably damaging 1.00
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
R7790:Mtus2 UTSW 5 148078188 missense probably benign 0.09
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTGTGCCTACATTTCCC -3'
(R):5'- TAGAACCTGGAACCTGCTGC -3'

Sequencing Primer
(F):5'- CCCAAATGACGTGAATATTCCTG -3'
(R):5'- AACCTGCTGCGTGCTAG -3'
Posted On2016-06-06