Incidental Mutation 'R5097:Olfr525'
ID388089
Institutional Source Beutler Lab
Gene Symbol Olfr525
Ensembl Gene ENSMUSG00000061489
Gene Nameolfactory receptor 525
SynonymsMOR251-2, GA_x6K02T2PBJ9-42472898-42473827
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140320858-140327625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140323095 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 132 (Y132C)
Ref Sequence ENSEMBL: ENSMUSP00000149361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078103] [ENSMUST00000214594]
Predicted Effect probably damaging
Transcript: ENSMUST00000078103
AA Change: Y132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077243
Gene: ENSMUSG00000061489
AA Change: Y132C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 260 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214594
AA Change: Y132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215542
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Olfr525
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Olfr525 APN 7 140323592 nonsense probably null
IGL02450:Olfr525 APN 7 140323227 missense possibly damaging 0.95
IGL02927:Olfr525 APN 7 140322741 missense probably damaging 1.00
IGL03008:Olfr525 APN 7 140323532 missense probably damaging 1.00
IGL03202:Olfr525 APN 7 140323106 missense possibly damaging 0.96
R0268:Olfr525 UTSW 7 140323155 missense possibly damaging 0.63
R0612:Olfr525 UTSW 7 140323188 missense possibly damaging 0.63
R0751:Olfr525 UTSW 7 140323325 missense probably benign
R0801:Olfr525 UTSW 7 140322918 missense probably damaging 1.00
R0940:Olfr525 UTSW 7 140323152 missense probably benign 0.01
R2220:Olfr525 UTSW 7 140323571 missense probably benign 0.03
R3748:Olfr525 UTSW 7 140323128 missense possibly damaging 0.87
R4660:Olfr525 UTSW 7 140323412 missense possibly damaging 0.67
R4683:Olfr525 UTSW 7 140322768 missense probably benign 0.01
R4887:Olfr525 UTSW 7 140323101 missense probably benign
R4919:Olfr525 UTSW 7 140323514 nonsense probably null
R5836:Olfr525 UTSW 7 140322914 missense probably benign
R7024:Olfr525 UTSW 7 140322846 missense possibly damaging 0.75
R8242:Olfr525 UTSW 7 140322783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTTCCCAAGCTGCTGG -3'
(R):5'- AGAGAAGGCTCGCTTCTTGC -3'

Sequencing Primer
(F):5'- CCAAGCTGCTGGAGGGTTTG -3'
(R):5'- CTGCAATGACAATCATGATGTTG -3'
Posted On2016-06-06