Incidental Mutation 'R5097:Micall1'
ID388105
Institutional Source Beutler Lab
Gene Symbol Micall1
Ensembl Gene ENSMUSG00000033039
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing -like 1
SynonymsD15N2e, Mus EST 820961, D15Mit260
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79108898-79136900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79129878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 658 (T658A)
Ref Sequence ENSEMBL: ENSMUSP00000042053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040320] [ENSMUST00000169604] [ENSMUST00000187550] [ENSMUST00000190959] [ENSMUST00000229031]
Predicted Effect probably benign
Transcript: ENSMUST00000040320
AA Change: T658A

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039
AA Change: T658A

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169604
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185944
Predicted Effect probably benign
Transcript: ENSMUST00000187550
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190959
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Micall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Micall1 APN 15 79115021 splice site probably benign
IGL00496:Micall1 APN 15 79115021 splice site probably benign
IGL00508:Micall1 APN 15 79130568 missense probably damaging 0.99
IGL01626:Micall1 APN 15 79130512 missense possibly damaging 0.46
IGL01868:Micall1 APN 15 79115060 missense probably benign 0.41
IGL03062:Micall1 APN 15 79114681 missense probably damaging 1.00
R0086:Micall1 UTSW 15 79125489 utr 3 prime probably benign
R0099:Micall1 UTSW 15 79131901 splice site probably benign
R0282:Micall1 UTSW 15 79131901 splice site probably benign
R0727:Micall1 UTSW 15 79120778 missense probably benign 0.00
R1859:Micall1 UTSW 15 79122945 intron probably benign
R2142:Micall1 UTSW 15 79130795 missense probably damaging 0.98
R2228:Micall1 UTSW 15 79129836 missense probably damaging 1.00
R3508:Micall1 UTSW 15 79122765 missense probably damaging 1.00
R4858:Micall1 UTSW 15 79122946 intron probably benign
R4888:Micall1 UTSW 15 79131848 nonsense probably null
R5059:Micall1 UTSW 15 79122834 intron probably benign
R5451:Micall1 UTSW 15 79126904 intron probably null
R5710:Micall1 UTSW 15 79127090 missense probably damaging 1.00
R5727:Micall1 UTSW 15 79130478 missense possibly damaging 0.64
R7135:Micall1 UTSW 15 79109424 missense unknown
R7186:Micall1 UTSW 15 79125375 missense unknown
R7297:Micall1 UTSW 15 79120897 missense unknown
R7472:Micall1 UTSW 15 79122560 missense unknown
Predicted Primers PCR Primer
(F):5'- CCATTTGCCGAATGAGTGTGG -3'
(R):5'- GATATGCAGGATCCCTAGGC -3'

Sequencing Primer
(F):5'- GATTCTGTTCTTGCCTGGGCC -3'
(R):5'- TATGCAGGATCCCTAGGCTAAGTC -3'
Posted On2016-06-06