Incidental Mutation 'R5097:Rpl3l'
ID388109
Institutional Source Beutler Lab
Gene Symbol Rpl3l
Ensembl Gene ENSMUSG00000002500
Gene Nameribosomal protein L3-like
Synonyms1110057H16Rik
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24727820-24736143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24733461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 218 (D218E)
Ref Sequence ENSEMBL: ENSMUSP00000129325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000101800] [ENSMUST00000115262] [ENSMUST00000170239] [ENSMUST00000183214]
Predicted Effect probably damaging
Transcript: ENSMUST00000045186
AA Change: D51E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500
AA Change: D51E

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101800
SMART Domains Protein: ENSMUSP00000099300
Gene: ENSMUSG00000075705

DomainStartEndE-ValueType
Pfam:SelR 5 105 9.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115262
SMART Domains Protein: ENSMUSP00000110917
Gene: ENSMUSG00000075705

DomainStartEndE-ValueType
Pfam:SelR 7 106 6.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170239
AA Change: D218E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: D218E

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183214
SMART Domains Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 133 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Rpl3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Rpl3l APN 17 24735471 missense probably damaging 0.96
IGL01364:Rpl3l APN 17 24732430 missense probably benign 0.07
IGL02009:Rpl3l APN 17 24732433 missense probably damaging 0.98
IGL02422:Rpl3l APN 17 24733988 nonsense probably null
IGL03309:Rpl3l APN 17 24736024 missense possibly damaging 0.64
PIT4468001:Rpl3l UTSW 17 24735483 missense probably benign 0.00
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1782:Rpl3l UTSW 17 24733456 missense probably benign 0.02
R2019:Rpl3l UTSW 17 24735516 unclassified probably benign
R2509:Rpl3l UTSW 17 24732386 missense possibly damaging 0.94
R3844:Rpl3l UTSW 17 24733942 missense probably benign 0.02
R4574:Rpl3l UTSW 17 24734010 missense possibly damaging 0.70
R4675:Rpl3l UTSW 17 24733610 missense probably benign 0.43
R5106:Rpl3l UTSW 17 24732437 missense probably damaging 1.00
R5187:Rpl3l UTSW 17 24732455 missense possibly damaging 0.95
R6073:Rpl3l UTSW 17 24730887 missense probably benign
R6295:Rpl3l UTSW 17 24733992 missense probably benign
R7624:Rpl3l UTSW 17 24732427 missense probably benign
R7655:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7656:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7834:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
R7917:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
Z1177:Rpl3l UTSW 17 24728398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACTGGTCTCTTCAGGTTGCC -3'
(R):5'- GGGTCTTCCTTGGAAGCTTC -3'

Sequencing Primer
(F):5'- GGGACTGTGAACTGACCTTAATTC -3'
(R):5'- AAGCTTCTTGGTATGCCAGC -3'
Posted On2016-06-06