Incidental Mutation 'R5098:Bcl2a1b'
ID388132
Institutional Source Beutler Lab
Gene Symbol Bcl2a1b
Ensembl Gene ENSMUSG00000089929
Gene NameB cell leukemia/lymphoma 2 related protein A1b
SynonymsA1-b
MMRRC Submission 042687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5098 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89199209-89207827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89199379 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000065612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068569]
Predicted Effect probably benign
Transcript: ENSMUST00000068569
AA Change: M7K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000065612
Gene: ENSMUSG00000089929
AA Change: M7K

DomainStartEndE-ValueType
BCL 37 140 5.55e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138109
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Card10 G A 15: 78,776,717 A1030V probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Dhx58 T C 11: 100,695,173 E674G probably benign Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Mybpc1 T C 10: 88,546,064 D588G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Tmem8 A T 17: 26,118,928 N429Y probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Zfp652 T C 11: 95,752,936 V140A probably damaging Het
Other mutations in Bcl2a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0379:Bcl2a1b UTSW 9 89199736 missense possibly damaging 0.95
R1307:Bcl2a1b UTSW 9 89199490 missense probably damaging 0.99
R2402:Bcl2a1b UTSW 9 89199742 missense probably benign 0.06
R4898:Bcl2a1b UTSW 9 89199660 nonsense probably null
R5710:Bcl2a1b UTSW 9 89199679 missense probably benign 0.01
R6594:Bcl2a1b UTSW 9 89207594 missense probably benign
R7059:Bcl2a1b UTSW 9 89199760 missense probably damaging 1.00
W0251:Bcl2a1b UTSW 9 89199583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCACAGTCTGAACTTTGGC -3'
(R):5'- GCGGTATCTATGGATTCCACG -3'

Sequencing Primer
(F):5'- GAACTTTGGCTTTCACAGACCG -3'
(R):5'- TGGATTCCACGTGAAAGTCATCC -3'
Posted On2016-06-06