Incidental Mutation 'R5098:Mybpc1'
ID 388134
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms 8030451F13Rik, Slow-type C-protein
MMRRC Submission 042687-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock # R5098 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 88518279-88605152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88546064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 588 (D588G)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect possibly damaging
Transcript: ENSMUST00000119185
AA Change: D574G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: D574G

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121629
AA Change: D588G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: D588G

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156573
AA Change: D213G
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: D213G

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.4818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Bcl2a1b T A 9: 89,199,379 M7K probably benign Het
Card10 G A 15: 78,776,717 A1030V probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Dhx58 T C 11: 100,695,173 E674G probably benign Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Tmem8 A T 17: 26,118,928 N429Y probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Zfp652 T C 11: 95,752,936 V140A probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88523003 missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88558691 missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88573497 nonsense probably null
R8494:Mybpc1 UTSW 10 88526429 missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88571585 missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88558575 missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88523044 missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88555639 missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88553306 missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88543753 missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88524967 critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88536335 missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88543762 missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88536395 missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88570635 missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTGAGTTCTCTAGATGAG -3'
(R):5'- TGTACAGGTCAGACACTTGGG -3'

Sequencing Primer
(F):5'- TAGTAAAAGAGAGATGCTGGTTGG -3'
(R):5'- TCAGACACTTGGGCCCGC -3'
Posted On 2016-06-06