Incidental Mutation 'R5098:Zfp652'
ID388137
Institutional Source Beutler Lab
Gene Symbol Zfp652
Ensembl Gene ENSMUSG00000075595
Gene Namezinc finger protein 652
Synonyms9530033F24Rik
MMRRC Submission 042687-MU
Accession Numbers

Ncbi RefSeq: NM_201609.2; MGI:2442221

Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R5098 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location95712673-95835115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95752936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Ref Sequence ENSEMBL: ENSMUSP00000115393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091565] [ENSMUST00000107717] [ENSMUST00000133070] [ENSMUST00000148945]
Predicted Effect probably damaging
Transcript: ENSMUST00000091565
AA Change: V320A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089153
Gene: ENSMUSG00000075595
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107717
AA Change: V320A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103345
Gene: ENSMUSG00000075595
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133070
AA Change: V320A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148945
AA Change: V140A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115393
Gene: ENSMUSG00000075595
AA Change: V140A

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
ZnF_C2H2 118 141 4.34e-1 SMART
ZnF_C2H2 148 170 2.53e-2 SMART
ZnF_C2H2 176 198 6.78e-3 SMART
ZnF_C2H2 204 226 2.95e-3 SMART
ZnF_C2H2 232 254 1.95e-3 SMART
ZnF_C2H2 260 282 1.15e-5 SMART
ZnF_C2H2 288 308 6.15e1 SMART
low complexity region 328 349 N/A INTRINSIC
low complexity region 364 396 N/A INTRINSIC
Meta Mutation Damage Score 0.3345 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI

All alleles(23) : Targeted(1) Gene trapped(22)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Bcl2a1b T A 9: 89,199,379 M7K probably benign Het
Card10 G A 15: 78,776,717 A1030V probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Dhx58 T C 11: 100,695,173 E674G probably benign Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Mybpc1 T C 10: 88,546,064 D588G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Tmem8 A T 17: 26,118,928 N429Y probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Other mutations in Zfp652
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0432:Zfp652 UTSW 11 95763739 missense possibly damaging 0.50
R0464:Zfp652 UTSW 11 95763649 missense probably damaging 0.99
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1920:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R1922:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R2090:Zfp652 UTSW 11 95754008 missense probably benign 0.14
R2290:Zfp652 UTSW 11 95750023 missense possibly damaging 0.58
R2656:Zfp652 UTSW 11 95749329 missense probably damaging 0.98
R4790:Zfp652 UTSW 11 95749609 missense probably damaging 0.99
R5073:Zfp652 UTSW 11 95750064 missense possibly damaging 0.65
R5209:Zfp652 UTSW 11 95763665 missense possibly damaging 0.66
R5569:Zfp652 UTSW 11 95749290 missense probably benign
R5905:Zfp652 UTSW 11 95749863 missense probably benign
R6026:Zfp652 UTSW 11 95749962 missense possibly damaging 0.95
R6054:Zfp652 UTSW 11 95749863 missense probably benign
R6629:Zfp652 UTSW 11 95763790 missense probably damaging 0.96
R6815:Zfp652 UTSW 11 95749404 nonsense probably null
R6932:Zfp652 UTSW 11 95763841 missense probably benign
R7384:Zfp652 UTSW 11 95753004 missense probably damaging 1.00
R7644:Zfp652 UTSW 11 95750088 missense probably damaging 1.00
R7667:Zfp652 UTSW 11 95749718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTCTGGTCTTGTGCCATGAATC -3'
(R):5'- CACTGTCCAACCTGATCATGC -3'

Sequencing Primer
(F):5'- CTGGTCTTGTGCCATGAATCTAAAG -3'
(R):5'- CTGACTGCAGTATGCTGACTCTG -3'
Posted On2016-06-06