Incidental Mutation 'R5098:Dhx58'
ID388139
Institutional Source Beutler Lab
Gene Symbol Dhx58
Ensembl Gene ENSMUSG00000017830
Gene NameDEXH (Asp-Glu-X-His) box polypeptide 58
SynonymsD11Lgp2e, B430001I08Rik, LPG2
MMRRC Submission 042687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5098 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100694884-100704271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100695173 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 674 (E674G)
Ref Sequence ENSEMBL: ENSMUSP00000017974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017974] [ENSMUST00000153494]
Predicted Effect probably benign
Transcript: ENSMUST00000017974
AA Change: E674G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017974
Gene: ENSMUSG00000017830
AA Change: E674G

DomainStartEndE-ValueType
DEXDc 2 207 2.86e-22 SMART
HELICc 387 475 3.85e-14 SMART
Blast:HELICc 497 543 4e-12 BLAST
Pfam:RIG-I_C-RD 552 667 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149869
Predicted Effect probably benign
Transcript: ENSMUST00000153494
SMART Domains Protein: ENSMUSP00000115268
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
Pfam:zf-met 42 67 6.4e-8 PFAM
low complexity region 79 102 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to EMCV infection and decreased susceptibility to VSV infection. Mice homozygous for a different knock-out allele exhibit increased susceptibility to WNV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Bcl2a1b T A 9: 89,199,379 M7K probably benign Het
Card10 G A 15: 78,776,717 A1030V probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Mybpc1 T C 10: 88,546,064 D588G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Tmem8 A T 17: 26,118,928 N429Y probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Zfp652 T C 11: 95,752,936 V140A probably damaging Het
Other mutations in Dhx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Dhx58 APN 11 100703926 missense probably damaging 0.97
IGL02476:Dhx58 APN 11 100702264 missense probably benign 0.00
R0103:Dhx58 UTSW 11 100695270 missense probably damaging 1.00
R0103:Dhx58 UTSW 11 100695270 missense probably damaging 1.00
R0137:Dhx58 UTSW 11 100696997 missense probably damaging 0.99
R0164:Dhx58 UTSW 11 100695324 missense probably benign 0.42
R0164:Dhx58 UTSW 11 100695324 missense probably benign 0.42
R0369:Dhx58 UTSW 11 100701548 critical splice donor site probably null
R0390:Dhx58 UTSW 11 100699264 missense probably damaging 1.00
R0606:Dhx58 UTSW 11 100702251 missense probably benign 0.00
R1710:Dhx58 UTSW 11 100703574 missense probably benign 0.20
R1816:Dhx58 UTSW 11 100703152 missense probably damaging 0.98
R1993:Dhx58 UTSW 11 100703490 splice site probably null
R2281:Dhx58 UTSW 11 100698154 critical splice donor site probably null
R3176:Dhx58 UTSW 11 100696979 missense probably damaging 1.00
R3276:Dhx58 UTSW 11 100696979 missense probably damaging 1.00
R4651:Dhx58 UTSW 11 100701359 missense probably damaging 1.00
R4652:Dhx58 UTSW 11 100701359 missense probably damaging 1.00
R4716:Dhx58 UTSW 11 100696971 splice site probably null
R5030:Dhx58 UTSW 11 100696137 missense probably damaging 1.00
R5082:Dhx58 UTSW 11 100696976 missense probably benign 0.29
R5394:Dhx58 UTSW 11 100698208 missense probably benign 0.00
R5397:Dhx58 UTSW 11 100703920 missense probably damaging 1.00
R5787:Dhx58 UTSW 11 100701319 missense possibly damaging 0.91
R5975:Dhx58 UTSW 11 100702209 missense probably damaging 0.98
R6310:Dhx58 UTSW 11 100699367 missense probably benign 0.01
R6935:Dhx58 UTSW 11 100698406 splice site probably null
R7311:Dhx58 UTSW 11 100698171 missense probably benign
R7908:Dhx58 UTSW 11 100695304 missense probably damaging 0.99
R8317:Dhx58 UTSW 11 100703562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGCATAATAATTCTCCTGCG -3'
(R):5'- GCTGGTCATCACAGAAGTCC -3'

Sequencing Primer
(F):5'- GGCATAATAATTCTCCTGCGTTCATC -3'
(R):5'- GGTCATCACAGAAGTCCAGTTTAAG -3'
Posted On2016-06-06