Incidental Mutation 'R5098:Card10'
ID388154
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Namecaspase recruitment domain family, member 10
SynonymsBimp1, CARMA3
MMRRC Submission 042687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5098 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78775138-78803042 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78776717 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1030 (A1030V)
Ref Sequence ENSEMBL: ENSMUSP00000129513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313] [ENSMUST00000164826] [ENSMUST00000170584]
Predicted Effect probably benign
Transcript: ENSMUST00000018313
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128389
Predicted Effect probably benign
Transcript: ENSMUST00000164826
AA Change: A1030V

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170
AA Change: A1030V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170584
AA Change: A981V

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170
AA Change: A981V

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Bcl2a1b T A 9: 89,199,379 M7K probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Dhx58 T C 11: 100,695,173 E674G probably benign Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Mybpc1 T C 10: 88,546,064 D588G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Tmem8 A T 17: 26,118,928 N429Y probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Zfp652 T C 11: 95,752,936 V140A probably damaging Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78778215 missense probably damaging 1.00
IGL02804:Card10 APN 15 78802449 missense probably damaging 1.00
PIT4366001:Card10 UTSW 15 78787431 missense probably benign 0.14
R0529:Card10 UTSW 15 78780475 critical splice donor site probably null
R0571:Card10 UTSW 15 78787401 missense possibly damaging 0.88
R1118:Card10 UTSW 15 78802443 missense possibly damaging 0.90
R1444:Card10 UTSW 15 78787841 splice site probably benign
R1632:Card10 UTSW 15 78791220 nonsense probably null
R1669:Card10 UTSW 15 78793953 missense probably benign 0.20
R1862:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1863:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1997:Card10 UTSW 15 78793975 missense probably damaging 0.99
R2046:Card10 UTSW 15 78787473 missense possibly damaging 0.91
R2084:Card10 UTSW 15 78792971 missense possibly damaging 0.81
R2509:Card10 UTSW 15 78780273 missense probably benign 0.00
R2511:Card10 UTSW 15 78780273 missense probably benign 0.00
R4274:Card10 UTSW 15 78780514 missense probably damaging 1.00
R4887:Card10 UTSW 15 78781524 missense possibly damaging 0.66
R4970:Card10 UTSW 15 78802380 critical splice donor site probably null
R5112:Card10 UTSW 15 78802380 critical splice donor site probably null
R5243:Card10 UTSW 15 78780672 missense possibly damaging 0.70
R5256:Card10 UTSW 15 78778251 missense probably damaging 0.98
R5985:Card10 UTSW 15 78791211 missense probably benign 0.01
R6089:Card10 UTSW 15 78802414 missense probably benign 0.02
R6357:Card10 UTSW 15 78799379 missense probably damaging 1.00
R6545:Card10 UTSW 15 78776810 missense probably damaging 1.00
R6865:Card10 UTSW 15 78802622 missense possibly damaging 0.70
R6907:Card10 UTSW 15 78787471 missense possibly damaging 0.82
R6920:Card10 UTSW 15 78802409 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGATGGAGGAGGCCTAG -3'
(R):5'- ATATGTATGCATGTGCGTGC -3'

Sequencing Primer
(F):5'- AGGCCCAGACATCTGATGG -3'
(R):5'- GTGCGTGCACATACACAGC -3'
Posted On2016-06-06