Incidental Mutation 'R5099:Mff'
ID388160
Institutional Source Beutler Lab
Gene Symbol Mff
Ensembl Gene ENSMUSG00000026150
Gene Namemitochondrial fission factor
Synonyms
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82724890-82752394 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 82750471 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073025] [ENSMUST00000078332] [ENSMUST00000160744] [ENSMUST00000160786] [ENSMUST00000160972] [ENSMUST00000161648] [ENSMUST00000162003]
Predicted Effect probably benign
Transcript: ENSMUST00000073025
SMART Domains Protein: ENSMUSP00000072784
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 239 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078332
SMART Domains Protein: ENSMUSP00000077446
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 291 2.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160044
SMART Domains Protein: ENSMUSP00000125005
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 130 7.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160632
Predicted Effect probably benign
Transcript: ENSMUST00000160744
SMART Domains Protein: ENSMUSP00000125629
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 137 2.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160750
SMART Domains Protein: ENSMUSP00000125223
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 155 6.2e-67 PFAM
Pfam:Miff 144 220 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160786
SMART Domains Protein: ENSMUSP00000125230
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 238 6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160972
SMART Domains Protein: ENSMUSP00000124200
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 152 8.1e-60 PFAM
Pfam:Miff 146 218 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161648
SMART Domains Protein: ENSMUSP00000124164
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 243 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162003
SMART Domains Protein: ENSMUSP00000124334
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 316 8.1e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188333
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces mitochondrial hyperfusion-induced apoptotic cell death of endothelial cells of cardiac microvessels after induced ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Mff
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Mff APN 1 82741975 missense probably damaging 1.00
IGL02934:Mff APN 1 82747094 missense probably damaging 1.00
IGL03381:Mff APN 1 82741940 missense probably damaging 1.00
R0652:Mff UTSW 1 82750564 missense possibly damaging 0.91
R0755:Mff UTSW 1 82750605 critical splice donor site probably null
R1215:Mff UTSW 1 82741888 missense probably benign 0.45
R2074:Mff UTSW 1 82751700 missense probably damaging 1.00
R2078:Mff UTSW 1 82741921 missense probably damaging 1.00
R2365:Mff UTSW 1 82735471 missense possibly damaging 0.74
R4498:Mff UTSW 1 82741780 intron probably benign
R5867:Mff UTSW 1 82750606 critical splice donor site probably null
R5984:Mff UTSW 1 82731127 missense probably benign 0.00
R6723:Mff UTSW 1 82751666 missense possibly damaging 0.91
R7135:Mff UTSW 1 82747091 nonsense probably null
R7373:Mff UTSW 1 82737117 splice site probably null
R7475:Mff UTSW 1 82745438 splice site probably null
R7792:Mff UTSW 1 82747081 critical splice acceptor site probably null
R8088:Mff UTSW 1 82751649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCCGTTATCATTGTTGC -3'
(R):5'- TGAATTCACGGAATCCACAGGAG -3'

Sequencing Primer
(F):5'- CGTTATCATTGTTGCATTTTCTGGC -3'
(R):5'- GCATCTACCACAGTCATG -3'
Posted On2016-06-06