Mutagenetix > Incidental Mutation

Incidental Mutation 'R5099:Rin2'

388166

Institutional Source

Beutler Lab

Gene Symbol

Rin2

Ensembl Gene

ENSMUSG00000001768

Gene Name

Ras and Rab interactor 2

Synonyms

RASSF4, 4632403N06Rik, 2010003K16Rik

MMRRC Submission

042688-MU

Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Essential gene?

Possibly non essential (E-score: 0.313) question?

Stock #

R5099 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145675215-145887616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145878901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 718 (C718Y)

Ref Sequence

ENSEMBL: ENSMUSP00000105632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]

AlphaFold

Q9D684

Predicted Effect

probably damaging
Transcript: ENSMUST00000094480
AA Change: C673Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: C673Y

Domain	Start	End	E-Value	Type
SH2	50	136	1.38e-3	SMART
low complexity region	175	187	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	375	385	N/A	INTRINSIC
low complexity region	393	411	N/A	INTRINSIC
Blast:SH2	540	576	2e-7	BLAST
VPS9	612	730	1.72e-68	SMART
RA	751	842	3.35e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110005
AA Change: C718Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: C718Y

Domain	Start	End	E-Value	Type
SH2	95	181	1.38e-3	SMART
low complexity region	220	232	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	380	397	N/A	INTRINSIC
low complexity region	420	430	N/A	INTRINSIC
low complexity region	438	456	N/A	INTRINSIC
Blast:SH2	585	621	2e-7	BLAST
VPS9	657	775	1.72e-68	SMART
RA	796	887	3.35e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145874

Predicted Effect

probably benign
Transcript: ENSMUST00000147976

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175017

Meta Mutation Damage Score

0.9126

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	C	19: 11,112,461		probably null	Het
Arsa	A	G	15: 89,475,339	L80P	probably damaging	Het
Bdkrb1	A	G	12: 105,604,274	D33G	probably benign	Het
Ccdc178	A	T	18: 22,105,591	V323E	probably benign	Het
Ceacam5	T	C	7: 17,745,588	V210A	probably damaging	Het
Dcdc2a	A	G	13: 25,107,698	E222G	probably benign	Het
Gbp9	A	T	5: 105,094,513	L120Q	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsr	T	A	8: 33,671,528	I121N	probably damaging	Het
Ift140	T	A	17: 25,090,700	M1068K	probably damaging	Het
Jakmip2	A	G	18: 43,568,108	I414T	probably benign	Het
Lpin2	G	A	17: 71,243,970	W708*	probably null	Het
Mecom	A	G	3: 29,985,316		probably benign	Het
Mff	C	T	1: 82,750,471		probably benign	Het
Neb	C	T	2: 52,195,448	C1545Y	probably damaging	Het
Olfr1083-ps	A	T	2: 86,607,216	N118K	unknown	Het
Olfr206	C	T	16: 59,344,903	G266D	probably benign	Het
Olfr467	A	G	7: 107,814,602	H6R	probably benign	Het
Ppm1n	A	T	7: 19,277,978	L392Q	possibly damaging	Het
Prr22	T	C	17: 56,771,467	F207L	probably benign	Het
Ptprv	T	C	1: 135,118,854		noncoding transcript	Het
Rpgrip1l	G	A	8: 91,248,722	T1089I	probably benign	Het
Scn1a	A	G	2: 66,277,801	V1510A	probably damaging	Het
Slfn3	A	T	11: 83,214,938	Y587F	probably damaging	Het
Sp2	T	C	11: 96,961,349	K250E	probably damaging	Het
Ssu2	A	G	6: 112,359,624	S333P	probably benign	Het
Strbp	T	C	2: 37,603,018	T419A	probably damaging	Het
Tada2b	A	T	5: 36,476,400	M203K	probably benign	Het
Tcrg-V5	G	T	13: 19,192,716	C111F	probably damaging	Het
Tmem176b	T	C	6: 48,834,529	Y62C	probably benign	Het
Tox	G	T	4: 6,688,958	Q469K	probably benign	Het
Tyw5	T	C	1: 57,388,705	N243D	probably damaging	Het
Ube2q2	T	A	9: 55,206,023		probably benign	Het
Ufl1	C	T	4: 25,275,914	R83Q	probably damaging	Het
Unk	A	G	11: 116,059,110	Q701R	probably benign	Het
Vmn1r60	A	T	7: 5,544,817	C95S	probably damaging	Het
Vmn1r81	A	G	7: 12,260,321	I120T	possibly damaging	Het

Other mutations in Rin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02928:Rin2	APN	2	145860006	splice site	probably benign
IGL03222:Rin2	APN	2	145860195	nonsense	probably null
IGL03371:Rin2	APN	2	145885926	utr 3 prime	probably benign
IGL03411:Rin2	APN	2	145860944	missense	probably damaging	0.99
D4043:Rin2	UTSW	2	145822363	missense	possibly damaging	0.61
R0025:Rin2	UTSW	2	145878832	splice site	probably benign
R0110:Rin2	UTSW	2	145861033	missense	probably benign
R0144:Rin2	UTSW	2	145876639	missense	probably damaging	0.96
R0510:Rin2	UTSW	2	145861033	missense	probably benign
R1326:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1327:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1328:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1329:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1330:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1544:Rin2	UTSW	2	145858446	missense	probably damaging	1.00
R1658:Rin2	UTSW	2	145876456	missense	probably benign	0.04
R1832:Rin2	UTSW	2	145861171	missense	possibly damaging	0.48
R1986:Rin2	UTSW	2	145878940	missense	probably damaging	1.00
R2137:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2167:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2170:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2260:Rin2	UTSW	2	145878904	missense	probably damaging	0.97
R2312:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2884:Rin2	UTSW	2	145860991	missense	probably benign	0.07
R3155:Rin2	UTSW	2	145860851	missense	probably benign	0.17
R3771:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3772:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3773:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3822:Rin2	UTSW	2	145822630	missense	probably benign	0.02
R3824:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3825:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3885:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3893:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3939:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3940:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4012:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4019:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4058:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4214:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4231:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4232:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4236:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4372:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4410:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4415:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4471:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4490:Rin2	UTSW	2	145822274	missense	possibly damaging	0.66
R4597:Rin2	UTSW	2	145860905	missense	probably benign	0.01
R5268:Rin2	UTSW	2	145844760	missense	probably benign
R5493:Rin2	UTSW	2	145860709	missense	probably damaging	1.00
R5622:Rin2	UTSW	2	145860379	missense	probably benign	0.07
R5947:Rin2	UTSW	2	145844943	intron	probably benign
R6280:Rin2	UTSW	2	145861019	missense	probably damaging	1.00
R7009:Rin2	UTSW	2	145883475	missense	probably damaging	1.00
R7531:Rin2	UTSW	2	145858499	missense	probably benign
R7824:Rin2	UTSW	2	145861117	missense	probably benign	0.00
R8065:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8067:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8144:Rin2	UTSW	2	145822305	missense	probably benign
R8510:Rin2	UTSW	2	145885691	missense	probably damaging	1.00
R8853:Rin2	UTSW	2	145876555	missense	possibly damaging	0.68
R8880:Rin2	UTSW	2	145848852	missense	probably damaging	1.00
R9224:Rin2	UTSW	2	145878902	nonsense	probably null
R9325:Rin2	UTSW	2	145885899	missense	probably benign	0.15
R9417:Rin2	UTSW	2	145844793	missense	probably benign	0.02
R9555:Rin2	UTSW	2	145876495	nonsense	probably null
R9631:Rin2	UTSW	2	145876517	missense	probably damaging	1.00
R9667:Rin2	UTSW	2	145860282	missense	possibly damaging	0.89
R9691:Rin2	UTSW	2	145848844	missense	probably damaging	0.97
R9727:Rin2	UTSW	2	145860586	missense	possibly damaging	0.94
R9780:Rin2	UTSW	2	145876631	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGTGAATTCCAGGAACTCCCAC -3'
(R):5'- CCAAAGTGGCTAATCTTACATTCCATG -3'

Sequencing Primer
(F):5'- GAACTCCCACACCTGTTTATAAGTAG -3'
(R):5'- AGTTCCTCTGACACATGG -3'

Posted On

2016-06-06